Pubmed abstracts for Protein-Protein Interaction search result :

Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.89944611
We conclude form this that H2B interacts simultaneously with H2A and H 4 in chromatin through separate binding sites . 0.89944611^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.72898227
The extent of this resistance , in response to various experimental parameters , is directly correlated to the strength of interaction between the H2a : H2b dimer and H 3 : H 4 tetramer subunits . 0.72898227^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.51230906
Tyrosines 83 and 121 of H2B were iodinated , both when the histone was free in solution and when it was associated with H2A , while tyrosines 37 , 40 , and 42 of H2B were not iodinated under either condition . 0.51230906^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.83594401
It is concluded that although the sequence of the N terminal domain of H2B can indirectly influence the free solution association constant with histone H2A , it does not take part in the interaction . . 0.83594401^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Fractions H2a and H2b interact to form the mixed dimer in equilibrium with monomers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A pH dependent interaction between histones H2A and H2B involving secondary and tertiary folding . ^^^ It has been shown by high resolution proton magnetic resonance ( PMR ) spectroscopy and circular dichroism ( CD ) that an H2A / H2B histone complex exists after salt extraction of these histones from chromatin and that this complex can be fully renatured from both urea denatured acid extracted and from urea denatured salt extracted histones . ^^^ From CD spectra the H2A / H2B complex is shown to contain about 37 % alpha helix but no beta structure , the latter being confirmed by infrared spectroscopy in the 6 mum region . ^^^ The PMR spectra show that the structured region includes most of the aromatic residues of both histones , at least two histidine residues of H2B and probably histidines 31 and 82 of histone H2A . ^^^ The secondary structure of histones H2A and H2B is predicted using the Chou and Fasman procedure and comparisons are made between the predictions for histones of different species . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The behaviour , upon variations in ionic strength , pH and temperature of 19F nuclear nuclear magnetic resonance signals of the trifluoroacetonylated derivative of histone H 3 is compared with those of the H 3 H4 complex and of the Hv fraction ( an equimolar mixture of H2A , H2B , H 3 and h 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Acetyltransferase A acetylates histones in the order : whole histone greater than H 4 greater than H2A greater than H 3 greater than H2B greater than H 1 ; acetyltransferase B in the order : whole histone greater than H 4 = H 3 greater than H2A greater than H2B greater than H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Electron microscopic and biochemical results are presented supporting the following conclusions : ( 1 ) Two molecules of each histone H2A , H2B , H 3 and H 4 are necessary and sufficient to form a nucleosome with a diameter of 12 . 5 + / 1 nm and containing about 200 base pairs of DNA . ( 2 ) H 3 plus H 4 alone can compact 129 + / 8 DNA base pairs into a sub nucleosomal particle with a diameter of 8 + / 1 nm . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The following order of histones is assumed : H2a , H2b , H 1 , H 3 , H 4 . ^^^ Activation of the DNA and RNA synthesis in the eucaryotic cells , their nuclei and chromatin under the effect of low heparin doses should be associated not with the H 1 histone dissociation , but with the dissociation of histones moderately rich in lysine H2a , and , probably , H2b . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The interactions of H 1 ( H1A , H1B ) , H2A , H2B , H 3 , H 4 , and H 5 with phenyl cross linked agarose were studied . ^^^ The absorption sequence based on the identification and quantitation of individual histones from either unfractionated ( whole ) histone or separate histone classes is as follows : H 3 greater than or equal to H 4 greater than H2B greater than or equal to H 5 greater than or equal to H2A greater than H1A greater than or equal to H1B . ^^^ Preferential interaction of H2A H2B , H 3 H4 , and H2A H2B H 4 occur ; these interactions can modify the original relative affinity of each individual component for the matrix . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The data indicate that 10 ANA recognize a complex consisting of the core histones H2A , H2B , H 3 , H 4 , and DNA of 140 to 200 base pairs in length . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Acidic urea gel electrophoresis of the histones from C . elegans yielded 4 main groups which were preliminary identified as H 1 , H2a ( + H 3 ? ) , H2b , H 4 and moved on the gels in that order of increasing mobility . the coincidence of histone H 3 with H2a was putative , but its presence was firmly suggested by the generation of a dimeric form in oxidizing conditions . 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 3 , H 1 , H2b , and H2a but not H 4 were ADP ribosylated in S phase nuclei . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The electrophoretic mobility of histones H 3 , H2b and H2a from three evolutionally unrelated sources ( trout and chicken erythrocytes and calf thymus ) is increased and that for histones H 1 and H 5 is decreased with respect to histone H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Furthermore , isolation of the histone core proteins , H2A , H2B , H 3 and H 4 , revealed that only 15 % of the carcinogen was associated with the histones and that the majority of the carcinogen was bound to chromosomal DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Other two fractions correspond to the histones H2A and H2B ; however , they have some pecularities . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The DNA was complexed with histone H 1 , with the combination of the other four histones H2A , H2B , H 3 and H 4 , and with whole histones . ^^^ The thermal denaturation profile and nuclease digestion pattern of DNA histone H2A , H2B , H 3 and H 4 complex were compatible with those of the polynucleosome structure of chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The labeled molecules include the histones H2A , H2B , H 3 , and H 4 ; and proteins A 3 , Aj , A 8 , A 8 ' , A 15 , A 16 , A 24 , B 7 , and B 13 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Adenosine 3 ' : 5 ' monophosphate dependent protein kinase ( protein kinase A ) purified from silkworm pupae phosphorylated five major fractions of calf thymus histone , whereas guanosine 3 ' : 5 ' monophosphate dependent protein kinase ( protein kinase G ) purified from the same organism reacted preferentially with H 1 , H2A , and H2B histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition , the individual histones vary in the degree of their affinity for BrdUrd DNA in the order H 3 greater than H 4 greater than H2A greater than H2B greater than H 1 . ^^^ The histones selectively retained BrdUrd DNA on filters in the order H 4 greater than H2A greater than H 3 greater than H2B greater than H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The stability of nucleosomes of SV 40 minichromosomes extracted from infected cells or reconstituted by association of SV 40 DNA and the four histones H2A , H2B , H 3 and H 4 was studied as a function of the ionic strength . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Four low molecular weight polypeptides migrating like H2a , H2b , H 3 , and H 4 calf liver histones were detected by sodium dodecyl sulfate acrylamide gel electrophoresis of highly purified preparations of bovine papillomavirus ( BPV ) and human papillomavirus ( HPV ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
None of these specific alterations in DNA structure is seen om complexing the slightly lysine rich histones H2A and H2B to DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Their electrophoretic mobilities in polyacrylamide gels and their amino acid compositions indicate that they are histones homologous , although not identical , to the H 1 , H2A , H2B , H 3 , and H 4 histones of mammals . ^^^ The finding of recognizable H 1 , H2A , H2B , H 3 , and H 4 histones in Neurospora extends the range of eukaryotes now shown to contain a full complement of these strongly conserved chromosomal proteins , and supports the view that histones became involved in chromosome structure at a very early point in the evolution of eukaryotes . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The purified enzyme displays high specificity for the lysine rich histones ( H 1 , H2b , H2a ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Guanosine 3 ' , 5 ' monophosphate ( cyclic GMP ) dependent protein kinase partially purified from silkworm pupae reacts preferentially with H 1 , H2A , and H2B histones but not with H 3 AND H 4 histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
No significant labeling of the nucleosomal ' core ' histones H2A , H2B , H 3 and H 4 was observed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The optimum concentration of Mg2+ varied with histone fractions employed ; with H2B histone as substrate the enzyme was most active at 50 to 100 nM Mg 2 ' ' , whereas with H 1 and H2A histones the maximum activity was observed at 5 to 10 mM Mg2+ and with H 3 and H 4 histones the enzyme was active over a range of 5 to 75 mM Mg2+ . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition , the relative contents of the major histones , H 1 , ( H2A + H2B + H 3 ) , and H 4 , were also constant in all fractions . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Nucleosome structure 1 : all four histones , H2A , H2B , H 3 , and H 4 , are required to form a nucleosome , but an H 3 H4 subnucleosomal particle is formed with H 3 H4 alone . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four histones H2A , H2B , H 3 and H 4 from calf thymus , CHO and sea urchin gastrula cells were associated by stepwise dialysis from 2 M NaCl with SV 40 DNA Form 1 . ^^^ These results support our previous proposal that the four histones H2A , H2B , H 3 and H 4 are able to organize more than 140 bp of DNA , but do not provide any evidence that the variability of histones H2A and H2B plays a role in the variability of the DNA repeat length of native chromatins . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The enzyme phosphorylates specifically histone H2B ( Vm = 236 min ( 1 ) , Km = 1 . 15 10 ( 5 ) M ) and to a lesser extent H2A , H 5 and H 1 ( Vm = 55 77 min ( 1 ) , Km 5 25 10 ( 5 ) M ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The system consists of histones H2A , H2B , H 3 , and H 4 , DNA relaxing enzyme , and a purified factor from Xenopus laevis stage 6 oocyte nuclei . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chicken erythrocyte core histones H2A , H2B , H 3 , and H 4 and lambdaDNA in 2 M NaCl were allowed to interact by stepwise decrease in the salt concentration . ^^^ Analysis of the DNA bound histones revealed that each of the histones in the pairs H2A , H2B and H 3 , H 4 was always present in equimolar amounts and that the relative proportion of each pair was constant between 1 . 4 and 0 . 8 M NaCl . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four core histones ( H2a , H2b , H 3 , and H 4 ) bound to simian virus 40 minichromosomes isolated from infected cells contain rapidly labeled acetyl groups in internal positions of the histone polypeptide chain . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When nucleosomal core histones were isolated from rat liver nuclei incubated with [ 14C ] NAD+ and fractionated into the individual components ( H2A , H2B , H 3 , and H 4 ) , [ 14C ] adenosine diphosphate ribose ( ADP Rib ) was found to be associated with all of them . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These four proteins were identified as histones H2A , H2B , H 3 and H 4 on the basis of their amino acid composition , molecular weight and solubility properties , all of which are very similar to the corresponding properties of the various histone proteins from other eukaryotic organisms . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The influence of a specific histone kinase , phosphorylating lysin rich histone H 1 , H2a , H2b on the physico chemical properties of chromatin from hepatocytes of normal and hepatectomized guinea pigs has been investigated . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
SV 40 virions contained histones H 3 , H2B , H2A , and H 4 but not H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chromatin was assembled in vitro from simian virus 40 DNA form 1 and the calf thymus four histones H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four core histones ( H2A , H2B , H 3 , and H 4 ) and DNA were assembled into nucleosome like particles at physiological ionic strengths either by an extract of chromatin rich in nicking closing activity or by the purified nicking closing enzyme itself . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The high affinity triiodothyronine binding capacity can be reconstituted by addition of a histone containing extract of chromatin of purified core histones ( H2A , H2B , H 3 , and H 4 ) ; a number of other acidic or basic proteins tested were ineffective . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A , H2B , H 3 and H 4 had little effect on the DNA independent enzyme activity , but were strongly inhibitory for the DNA dependent enzyme . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The tendency to aggregate increased in the order ; histone F2c ( H 5 ) ( non aggregating ) , histone F2b ( H2B ) , histone F2a2 ( H2A ) , histone F 3 ( H 3 ) , histone F2a1 ( H 4 ) ( highly aggregating ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Since homogeneous preparations of histones H2A , H2B , and H 3 , or any mixture of these four histones , can form similar structures , it seems likely that the basic organization of chromatin is determined by a fibrous histone core around which the DNA is wrapped . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The H 3 dimer can be substituted for undimerized H 3 in experiments in which the nucleosome is reconstituted from DNA and mixtures of the four `` core ' ' histones , H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A stable histone core complex containing equimolar ratios of H2A , H2B , H 3 , and H 4 has been isolated from chicken erythrocyte chromatin in high salt . ^^^ Analysis of the apparent weight average molecular weight as a function of concentration indicates that the histone core complex in 2 M NaCl , pH 9 . 0 , is in equilibrium between a tetramer ( H2A ) ( H2B ) ( H 3 ) ( H 4 ) and an octamer [ ( H2A ) ( H2B ) ( H 3 ) ( H 4 ) ] 2 species with a tetramer molecular weight of 55 , 000 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In both cases , the four nucleosomal histones ( H2A , H2B , H 3 , and H 4 ) are essentially the only proteins that remain bound to DNA and that are labeled by [ 3H ] arginine . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The H 3 , H2A , H2B , and H 4 late mRNAs are 15 40 nucleotides shorter than their early counterparts . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These results , together with those concerning histone H 4 acetylation levels and ratios of variants of histones H 3 and H2A that are like those in the dominant parent cell type , indicate that the control mechanisms affecting H 1 and H2B expression in H greater than M and in M greater than H hybrid cells affect expression of histones H2A , H 3 , and H 4 genes as well . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Purified A 24 in solution was shown to exhibit the same specificity of interaction with histone H2B as is exhibited by histone H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A relatively stable specific complex of the chromatin core histones H2A , H2B , H 3 , and H 4 has been obtained in 2 M NaCl / 25 mM sodium phosphate buffer , pH 7 . 0 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , electrophoretic analysis indicates complete disappearance of histones H 1 and partial loss of H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The syntheses of histones H 3 and H 4 plus H2A were affected to a much greater degree than those of histones H 1 and H2B , suggesting a tight coupling between the syntheses of DNA and histones H 3 and H 4 plus H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The predominant 11S component appears to be identical to chromatin `` subunits ' ' or `` nucleosomes ' ' isolated from higher eukaryotes , containing a 150 160 base pair length of DNA and approximately equimolar amounts of four proteins that coelectrophorese with calf histones H2A , H2B , H 3 , and H 4 , plus small amounts of three proteins that electrophorese similarly to H 1 histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Complexes between the four calf thymus histones ( H2A , H2B , H 3 and H 4 ) and colE 1 plasmid DNA have been reconstituted using the procedure of Oudet et al . ( ( 1975 ) , Cell 4 , 281 300 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The appearance of regular and discrete bands at sizes much larger than the repeat size shows that the core particles ( 140 bp of DNA + H2A , H2B , H 3 H4 ) in at least some fraction of chromatin are spaced in a particular fashion , by discrete lengths of spacer DNA , and not randomly . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Four histones ( H 3 , H2a , H2b and H 4 ) take part in the formation of each fold . ^^^ Total sequence of histones along DNA is H 1 H3 H2a H2b H 4 H4 H2b H2a H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Each of the purified histones H2a , H2b , H 3 and H 4 as well as N terminal peptides of H 4 histone cause relative shielding of the DNA major groove by 15 18 % like whole histone does . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Yeast chromatin , isolated by a rapid procedure contains in addition to histones H2A , H2B , H 3 and H 4 a fifth major basic protein . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Fractionation of acid soluble proteins from yeast Saccharomyces cerevisiae chromatin by gel electrophoresis suggested the existence of four histonestone fractions H2a , H2b , H 3 , H 4 and histone H 1 like protein . ^^^ The sequence of the electrophoretic mobilities of histone fractions from yeast coincides with those of histone fractions from plants H 4 greater than H 3 greater than H2a greater than H2b greater than H1 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
H2a , H2b , and H 3 have diverged . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Purified core histones ( H2A , H2B , H 3 , and H 4 ) and bacteriophage T 7 DNA have been reconstituted to form a nucleoprotein complex , and the properties of this complex as a template for transcription by Escherichia coli RNA polymerase have been studied . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Immune antisera to 5 fractions ( H 1 , H2a , H2b , H 3 , H 4 ) of calf thymus histone were assayed using indirect immunofluorescence ( IIF ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using two dimensional electrophoresis , differential staining of electrophoregrams and ion exchange chromatography on CM cellulose the total preparation has been found to be made up of five fractions : two arginine rich ( one of them identical to histone H 4 , the other being similar to histone H 3 from calf thymus ) ; two moderately lysine rich fractions , slightly differing in their properties from histones H2A and H2B from calf thymus , and one specific fraction with mol . weight of 16 000 and an extremely high positive charge . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Thus , high molecular weight chromatin containing only lysine rich histones ( H 1 and H 5 ) and core histones ( H2A , H2B , H 3 , and H 4 ) is not a true self assembling system in vitro using the salt gradient dialysis system used herein . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The association of histones H2A , H2B , H 3 , and H 4 in solution has been studied . ^^^ The pairs of histones H2A , H2B and H 3 , H 4 studied separately under identical conditions only associated as equimolar complexes consistent with dimeric and tetrameric structures , respectively . ^^^ The octamer dissociates by losing dimers of H2A , H2B until the main complexes existing in solution are the H3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Conversely , a large reduction in ADP ribosylation was seen in core histones ( H2A , H2B , and H 3 ) from the same nuclei . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Low resolution models of self assembled histone fibers from 10 ray diffraction studies . 10 ray diffraction data from self assembled histone fibers are presented for three systems : H 4 , H 3 H4 , and the four core histones H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A new procedure for purifying histone pairs H2A + H2B and H 3 + H 4 from chromatin using hydroxylapatite . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Similarily , two different H2A H2B dimers and two different H2A H2B H 4 trimers have been partially characterized . ^^^ The data suggest a functional map for H2B in which the N terminal third interacts with DNA , the middle third interacts with H2A , and the C terminal third interacts with H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Tryptic peptide and partial sequence analysis of the cross linked product has shown that the covalent linkage is between tyrosine 37 , 40 , or 42 ( we have not yet determined which ) of H2B and proline 26 of H2A . ^^^ We conclude that these residues constitute part of the hydrophobic H2A H2B binding domain within the nucleosomes of native chromatin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The same major H2A H2B and H2B H 4 cross linked dimers are formed as in mammalian chromatin . ^^^ Interspecies complexes formed between leek and calf H2A and H2B can be cross linked by UV light with the same specificity as intraspecies H2A H2B complexes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The enzyme hydrolyzed various histones ( H 1 , H2a , H2b , H 3 ) , casein and protamine but did not split hemoglobin , serum albumin and 14C tryptophane labelled total protein from chicken embryos . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chicken erythrocyte inner histones ( H2A , H2B , H 3 and H 4 ) were associated with the two complementary homopolymeric polydeoxyribonucleotides and the two alternating copolymeric polydeoxyribonucleotides . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Reconstructed complexes of the inner histones ( H2A , H2B , H 3 , H 4 ) and a variety of DNAs were digested with micrococcal nuclease to yield very homogeneous populations of core nucleosomes ( nu 1 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These experiments demonstrate that the core histone complex of H2A , H2B , H 3 , and H 4 can itself protect DNA sequences as long as 168 bp from nuclease . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These can be resolved by gel filtration on Bio Gel P 60 with subsequent CM cellulose ion exchange chromatography into five histone fractions containing families of histones H2A and H2B . 2 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
H2B migrated faster than the H2A fractions like in Echinoderms . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Recently H 6 has been located as a stoichiometric component of a distinct subset of trout testis nucleosomes that are complexed with a core nucleosome comprising 140 base pairs of DNA and the inner histones H2A , H2B , H 3 and H 4 [ Levy , W . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Neoplastic and nontransformed cells contained similar quantities of histones H 4 , H 3 , H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A highly homogeneous 145 base pair fragment of double helical poly ( dA dT ) . poly ( dA dT ) was obtained by micrococcal nuclease digestion of a semisynthetic chromatin prepared from the nucleosome core histones ( H2A , H2B , H 3 , H 4 ) and the synthetic polydeoxyribonucleotide . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Tritium labeled complementary RNA ' s to two cloned sea urchin DNA sequences , one coding for histones H 1 , H2B , and H 4 and the other for H2A and H 3 , were hybridized in situ to high resolution human chromosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Four bands in the early mRNA sample are identified as H 1 , H 3 , H2A `` H2B , and H 4 mRNA while at least 10 bands can be seen in the late mRNA preparation with unambiguous identification of H 1 , H2B , and H 4 mRNAs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Core histones ( H2A , H2B , H 3 , and H 4 ) are reconstituted by salt gradient dialysis with DNA molecules ranging in length from 177 bp down to 50 bp . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The mononucleosomes appeared normal in terms of sedimentation behavior , DNA length , and content of histones H2A , H2B , H 3 , and H 4 , but lacked H 1 , and instead were associated with approximately stoichiometric amounts of HMG 1 and HMG 2 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
One component ( MN 1 ) of the mononucleosomes had a higher mobility , contained histones H2A , H2B , H 3 , H 4 , and shorter DNA fragments ( 140 base pairs ) while the other ( MN 2 ) contained all five histones and longer DNA fragments ( 180 base pairs ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The major variants of chicken H2A and H2B differ from the analogous component of calf thymus by a small number of conservative amino acid substitutions in the basic terminal regions , which interact with DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The individual histone fractions H 1 , H2A , H2B and H 3 also failed to stimulated DNA synthesis . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Individual histones , especially H2a , H2B , and H 3 , also facilitate rebinding of purified E2R to oligo ( dT ) cellulose , while H 1 is less effective . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two types of sequences are involved in the dyad symmetry ; one is H 1 , H 3 and H 4 specific , the other is H2A and H2B specific . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have prepared semi synthetic chromatin core particles from a complex of chicken erythrocyte inner histones ( H2A , H2B , H 3 and H 4 ) with double stranded poly ( dAdT ) . poly ( dAdT ) and studied the conformation of the phosphodiester backbone using 31P NMR at 109 . 3 MHz . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In this case , the binding of histones H2A , H2B , H 3 , and H 4 to DNA cellulose closely resembles their binding to native chromatin . ^^^ The binding to DNA cellulose of histones H2A , H2B , H 3 , and H 4 , which have had the first 20 to 30 amino acid residues removed from their NH 2 termini , is indistinguishable from the binding to DNA cellulose of the same intact histones , as judged by their salt elution profile . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The plasmid pLpA contains the coding regions for H 1 , H 4 , H2B and H 3 histones , and we determined that the DNA fragment D is tandem to A in native DNA and that it contains the H2A gene . ^^^ The plasmids pLpB and pLpC contain the histone genes H2A H 1 H4 and H2B H 3 , respectively , and together contain the sequences for the five major histones . ^^^ This result revealed that the L . pictus histone genes have a polarity which is the same as other sea urchin histone genes examined to date that is , 3 ' H 1 H4 H2B H 3 H2A 5 ' . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Isolation of yeast histone genes H2A and H2B . ^^^ Analysis of cloned sequences for yeast histone genes H2A and H2B reveals that there are only two copies of this pair of genes within the haploid yeast genome . ^^^ Within each copy , the genes for H2A and H2B are separated by approximately 700 bp of spacer DNA . ^^^ Sequence homology between the two copies is restricted to the genes for H2A and H2B ; the spacer DNA between the genes is nonhomologous . ^^^ In both copies , the genes for H2A and H2B are divergently transcribed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
P 2 fraction contained four histones H2A , H2B , H 3 , and H 4 in almost equal amounts , together with nonhistone protein of low molecular weight . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Thus , intramolecular cross linking was found between Lys 5 and Lys 9 of H2A , and Lys 34 and Lys 85 of H2B , while intermolecular cross linking was found between Lys 24 ( or 27 ) of H2B and Lys 74 of H2A , Lys 85 of H2B and Lys 91 of H 4 , and Lys 120 of H2B and Lys 115 of H 3 and / or Lys 77 of H 4 . ^^^ All the 5 or 6 cross links can be located in a heterotypic tetramer consisting of one molecule each of H2A , H2B , H 3 , and H 4 , and a model of the histone arrangement in the tetramer is proposed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Increased amounts of proteins HMG 14 AND HMG 17 and small amounts of HMG 1 and HMG 2 were found associated with the four core histones H2A , H2B , H 3 and H 4 in these nucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The subunits contain approximately 195 base paris ( bp ) of DNA and histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A complex derived from chromatin containing one molecule of each of histones H2A , H2B , H 3 , and H 4 , termed core protein , was studied by 13C and 1H nuclear magnetic resonance . 13C line widths , when analyzed and compared with those of native and thermally unfolded representative globular proteins , showed that regions of the core protein possess considerable mobility . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These findings suggest that fractions P 1 , P4a , P4b , P 5 and P 6 of slime mold Ph . polycephalum are homologus with respect to the histone fractions H 1 , H 3 , H2b , H2a and H 4 of calf thymus . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The strength of DNA binding by histone columns is in the order H 5 greater than H 1 greater than greater than H2B approximately H 3 greater than H 4 approximately H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2a , H2b , H 3 , and H 4 associated with DNA are relatively resistant to acrosin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
All ten possible dimers of the four non H 1 histones , H 3 , H2B , H2A and H 4 , are observed , the major dimers being H 3 H3 , H 3 H2A , H2B H2A , H2a H2A and two separate dimers of H2B H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Several of the subfractions thus isolated have been characterized by amino acid composition and partial amino acid sequences as a series of variants of the histones H 1 , H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B are neighbors along DNA in chromatin : characterization of subnucleosomal particles containing H2A+H2B . ^^^ Two specific slow sedimenting nucleoprotein particles containing equimolar amounts of histones H2A and H2B and 38 or 49 base pair ( bp ) lengths of DNA have been isolated by centrifugation on sucrose gradients . ^^^ These results indicate that H2A and H2B are proximate along DNA in nucleosomes and alone can alter the optical activity and perhaps conformation of local regions of DNA . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Intrinsic and extrinsic fluorescence of histones H2A and H2B : a conformational study . ^^^ Intrinsic and extrinsic fluorescence measurements suggest that H2A and H2B histones , in a partially secondary structure , self aggregate into assemblies in which some tyrosine groups are buried in a hydrophobic environment and show enhanced fluorescence , 2 p toluidinylnaphthalene 6 sulfonate ( TNS ) indicates heterogeneity among the binding sites whose number depends on the pH values of the solutions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We find that the slightly lysine rich histones ( H2A and H2B ) but not the arginine rich histones ( H 3 and H 4 ) dissociate more slowly from nucleoids containing superhelical DNA than from those containing relaxed DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Calf thymus DNA was reconstituted with arginine rich histones H 3 and H 4 and slightly lysine rich histones H2A and H2B respectively . ^^^ Complexes containing histones H 3 and H 4 exhibit nucleosome like structures when examined in the electron microscope and show a restriction of in vitro transcription similar to that obtained for reconstitutes made up from the four histones H2A , H2B , H 3 and H 4 . ^^^ One the contrary , complexes of DNA and histones H2A and H2B create different morphological structures of short stretches of bound histones and do not cause a template restriction in vitro . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It has been demonstrated by digestion studies with micrococcal nuclease that reconstitution of complexes from DNA and a mixture of the four small calf thymus histones H2A , H2B , H 3 , and H 4 leads to subunits closely spaced in a 137 + / 7 nucleotide pair register . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The amino acid sequences of bovine histones H2A , H2B , H 3 , and H 4 and the first 107 residues of rabbit thymus histone H 1 were examined using newly developed procedures designed to detect and evaluate weak similarities ( de Han et al . , 1976 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The order of reassociation of the four histones H2a , H2b , H 3 and H 4 to the DNA during the reconstitution of chromatin was determined . ^^^ We show that H 3 and H 4 bind first to the DNA between 1 . 2 M NaCl and 0 . 85 M NaCl and impose a nucleosome like structure ; in a second step histones H2a and H2b are placed around this kernel to complete the nucleosome . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone proteins were isolated from both normal and tumour rat blood plasma : H 1 , ( H2b + H2a ) for normal plasma and H 1 , H 3 , ( H2b + H2a ) and H 4 for tumour one . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Crosslinks between H 4 and H2a , H 4 and H2b , H 4 and H 3 , H2a and H2b , H2b and H 3 were found . ^^^ After micrococcal nuclease treatment to generate nucleosomes , H2a and H2b are crosslinked faster than H 4 and H 3 . ^^^ C 14 NEM titration of thiopropionate residues bound to each histone shows that H2a and H2b are more accessible to this reagent after nuclease treatment but that the increased binding was not sufficient by itself to explain the increase in crosslinking . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A procedure is described of the isolation of protein kinase , which phosphorylates isolated troponin T with a rate , 5 30 fold exceeding the phosphorylation rate of other substrates ( phosvitine , caseine , protamine sulphate , H 1 , H2A , H2b , H 3 , H 4 histones ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Low molecular weight histone complexes of H2A ( congruent to dimer ) , H2B ( congruent to tetramer ) , H 3 H 4 ( congruent to tetramer ) , H2A H2B ( congruent to dimer ) , and H2B H 4 ( congruent to dimer ) have been prepared in 2 M NaCl and neutral pH at 4 degrees C . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The ratio of fractions H 4 , H 3 , H2A , H2B as well as the ratio of histone H 1 subfractions in the nucleus and in the rest of the 4 chromosome can not be visually distinguished . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Equimolar amounts of histones H2A and H2B were found , by two independent labeling experiments , to be cross linked to the DNA . ^^^ This arrangement allows histones H2A and H2B to preferentially cross link to the DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The binding of histones in chromatin core particles and in core particles depleted of histones H2A and H2B has been studied by high resolution proton nuclear magnetic resonance ( NMR ) at 270 MHZ . ^^^ Further , whereas the apolar regions of H2A and H2B are also bound to the core particle , the basic N terminal and C terminal regions are more mobile and give rise to sharp resonances in the NMR spectrum of the core particle . ^^^ The interactions between histones and DNA in the core particle thus involves H 3 and H 4 and the apolar regions of H2A and H2B . ^^^ It is suggested that these basic regions of H2A and H2B have binding sites outside the core particle . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A protein complex , extracted from calf thymus chromatin with 2 M NaCl , pH 7 . 5 , containing approximately equal molar ratios of histones H2A , H2B , H 3 , and H 4 , has been characterized in this study . ^^^ In the second part of this study , we demonstrate that the bonds maintaining the octameric complex in 2 M NaCl are weak and distinctly different from the forces stabilizing the H2A H2B dimer or H 3 H4 tetramer . ^^^ The octamer is dissociated into two H2A H2B dimers and one H 3 H4 tetramer by ( 1 ) increasing temperature ; ( 2 ) decreasing NaCl concentration ; ( 3 ) adding low concentrations of urea or guanidine hydrochloride ; and ( 4 ) lowering the pH below 7 or raising it above 10 . ^^^ The first set involves mostly hydrophobic interactions and yields the H2A H2B dimer and the H 3 H4 tetramer subunits . ^^^ The second set involves the weak association of one H 3 H4 tetramer with two H2A H2B dimers to form an octamer . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Geometric complementarity of the primary structures of histone molecules H2A , H2B , H 3 , H 4 and several possible consequences of this phenomenon ] . ^^^ The paper treats of the correlations between the position geometry of the extended successions of the residue of basic amino acids and those nonbearing any positive charge along the polypeptide chains of the histone H2A , H2B , H 3 , H 4 molecules forming nucleosomes protein frame . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Between 0 . 7 and 1 . 2 M NaCl H2a H2b bind non cooperatively as an equimolar complex with deltaGo = 1 . 6 Kcals / mole at 4 degree C and 1 . 0 M NaCl . ^^^ The proper binding of H2a and H2b requires the presence of bound H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In all lines tested , butyrate caused hyperacetylation of H 3 and H 4 , and in rat IRC 8 cells , H2A and H2B were also affected . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Stage specific mRNAs coding for subtypes of H2A and H2B histones in the sea urchin embryo . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition , among the chromatin subfractions studied , histones H 3 , H2B , and H 4 are essentially equimolar , while histone H2A is less than equimolar by 19 + / 9 % . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The yeast , Saccharomyces cerevisiae , contains four types of histones resembling histones H 3 , H2b , H2a , and H 4 of animal cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Sera examination by the complement fixation test demonstrated antigenicity of the total histone preparation protein components to decrease in the following order : nonhistone proteins admixture greater than histone fraction HI greater than mixture of histone fractions H 3 : H2b : H2a ( 1 : 1 : 1 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The six pairwise interactions of Tetrahymena macronuclear histones H2A ( formerly HX ) , H2B , H 3 , and H 4 have been studied using the techniques of circular dichroism and continuous variation . ^^^ The behavior of three of the ciliate histones , H2A , H2B , and H 3 is virtually identical with that of their vertebrate counterparts . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The protein care is a histone octamer containing two copies each of the four main types of histones , H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Large increases in the incorporation of [ 3H ] lysine into the H 1 and H 3 histones were observed when compared to histone bands from control mice , with smaller but significant increases of incorporation occurring into the H2B , H2A , and H 4 fractions . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The DNA sequence of sea urchin ( S . purpuratus ) H2A , H2B and H 3 histone coding and spacer regions . ^^^ One sequence contains the contiguous H2B and H 3 genes and their interdigitated spacer regions ; the other comprises the H2A gene and flanking spacer sequences . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Antibodies were produced against histones H 1 , H2A , H2B , and H 3 of both species and the extent of cross reaction was measured by microcomplement fixation . ^^^ The results allowed the identification of rye histones H2A and H2B . ^^^ The interspecific differences found for both H2A and H2B were greater , the amino acid difference estimated from the immunological distance being between 10 and 20 % . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The patterns of the core histones ( H2A , H2B , H 3 , and H 4 ) remain relatively constant during development , while histone H 1 shows unusual chromatographic properties in the 30 and 35 day hybrid preparations . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The oligomers thus obtained were ( 1 ) pentamer and trimer of H 1 , ( 2 ) tetramer of H2A and H2B , and ( 3 ) tetramer and higher aggregates of H 3 and H 4 , under the following ionic conditions : 0 . 5 M NaCl 0 . 05 M phosphate buffer ( pH 7 . 0 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Electrophoresis of these proteins in three different systems ( urea starch , urea acetic acid polyacrylamide , and discontinuous SDS polyacrylamide ) showed that the A . nidulans histones H 3 and H 4 were nearly identical to calf thymus H 3 and H 4 with respect to net charge and molecular weight criteria , whereas the fungal histones H 1 , H2a and H2b were similar but not identical to the corresponding calf thymus histones . ^^^ Amino acid analysis of A . nidulans histones H2a , H2b , and H 4 showed them to be closely related to the homologous calf thymus histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Although macronuclear histone 10 resembles H2A in chromatographic and some solubility properties more like H2B than H2A . ^^^ While it is possible that one form is H2A like and the other more H2B like , the observation that both forms of 10 behave identically in solubility fractionation schemes makes this unlikely . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Triton reduced the electrophoretic mobility and distribution coefficient of various histone species in the following order of decreasing effect ; H2A greater than H 3 , H 4 greater than H2B greater than H 1 in the absence of urea . ^^^ Urea antagonized the surfactant effect more for H 4 and H2B , and less for H2A and H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These 11S chromosomal particles ( nucleosomes ) contain a DNA fragment 140 180 base pairs long and an equal mass of histones , H2A , H2B , H 3 , and h 4 . nucleosomes were incubated with purified antibodies to histones H2A and H2B and to hemoglobin A , and the resulting complexes were analyzed by ultracentrifugation . ^^^ When nucleosomes are thus dispersed on the basis of reaction with anti H2B , the ratios of H2A to H 4 and of ( H2B + H 3 ) to H 4 are identical ( + / 8 % ) for all fractions , suggesting that each nucleosome has an identical histone complement , two each of histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The non viscous folded DNA sediments as a single broad 5000S peak in a complex with RNA ( a fraction of the nuclear nascent RNA ) and protein ( all of the four intranuclesome histones : H2A , H2B , H 3 , and H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The results of these studies indicate that poly ( A ( ) ) 4 to 18 S RNA from S phase HeLa polyribosomes contains : ( a ) large quantities of discrete 7 . 4 and 8 S RNA species which are not functional histone mRNA ; ( b ) a discrete 8 . 6 S RNA fraction which contains the templates of human histone H 4 ; ( c ) 9 . 2 to 10 . 7 S RNA which contains mixtures of incompletely resolved histone H2B , H2A , and H 3 mRNA ( These mRNA species do not closely correspond to discrete RNA subfractions resolvable by our techniques . ) ; ( d ) discrete 12 and 13 S RNA fractions which contain templates of human histone H 1 polypeptides . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
All newly synthesized histones , H 1 , H 5 , H2a , h2b , h 3 , and H 4 undergo phosphorylation ; histones H2a , H2b , H 3 , and H 4 , are acetylated and histones H 3 and H 4 are methylated . ^^^ Furthermore , the reticulocytes show a unique pattern of enzymatic modification : phosphorylation of histone H2b , acetylation of histones H2a , H2b , H 3 , and H 4 , and methylation of histones H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2a , H2b , H 3 , and H 4 are present in equimolar amounts in chick erythroblasts . ^^^ H2a , H2b , H 3 , and H 4 are found to be present in nearly equimolar quantities . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The particles contain histones H2A , H2B , H 3 , H 4 , and a complement of nonhistone chromosomal proteins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The index of dissimilarity between calf and Drosophila histones are : H 4 , 1 . 0 ; H2B , 1 . 0 ; H 3 , 1 . 6 ; H2A , 2 . 0 ; H 1 , 16 . ^^^ The strong immunological cross reaction between calf and Drosophila histones H 4 , H 3 , H2A , and H2B leads us to suggest that antibodies elicited against purified histone fractions derived from calf thymus can serve as `` universal ' ' reagents for various studies of chromatin bound histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Pea histones H2a , H2b , H 3 , and H 4 have been isolated and their interactions studied by fluorescence anisotropy , light scatter , and circular dichroism . ^^^ Histones H 3 and H 4 are almost identical in plants and animals , but plant histones H2a and H2b differ markedly from their mammalian counterparts . ^^^ Despite these differences between calf and pea histones , the strong interactions between histone pairs H 3 and H 4 , H2b and H 4 , and H2a and H2b , previously demonstrated for calf histones , also exist for pea histones . ^^^ There are also weak interactions between pea H2a and H 4 and between pea H2b and H 3 , and an interaction of intermediate strength between H2a and H 3 . ^^^ A . , Jr . , and Isenberg , 1 . ( 1974 ) , Biochemistry 13 , 4992 ] , despite the dissimilarities of H2a and H2b . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The interactions of DNA with the five histone components ( H 1 , H2B , H2A , H 3 and H 4 ) and with a number of histone fragments ( N H 1 ( 1 72 ) , C H 1 ( 73 216 ) , N H2B ( l 59 ) , C H2B , ( 63 125 ) , N H2A ( 1 39 ) , C H2A ( 58 129 ) , N H 4 ( 1 84 ) and C H 4 ( 85 102 ) have been studied by using the techniques of thermal denaturation and solubility behaviour . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Laser Raman spectra of calf thymus histones H 1 , H2A , and H2B . ^^^ Laser Raman spectra of the calf thymus histones H 1 , H2A , and H2B in aqueous solutions are presented . ^^^ The amide 3 regions of the Raman spectra of the slightly lysine rich histones H2A and H2B shows two bands at 1247 and 1265 cm 1 for H2A , and at 1254 and 1265 cm 1 for H2B . ^^^ The high frequency component at 1265 cm 1 is assigned to the alpha helical and rigid disordered structures of H2A and H2B , since this band increases in intensity upon addition of NaCl . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In particular , the relative amounts of the two slightly lysine rich histones H2A and H2B remaining on the BrUdR chromatin proved to be about 3 fold higher than those remaining on the control chromatin of TdR treated animals . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Heparin treatment of unfractionated histones isolated from nuclei of Chinese hamster cells indicates that the affinities of the histone classes for heparin appear in the order from greatest to least : ( H 3 , H 4 ) greater than ( H2A , H2B ) greater than H 1 . ^^^ The release of these four histones ( H2A , H2B , H 3 , and H 4 ) is coordinate and occurs in a highly cooperative manner , as indicated by ( 1 ) dependence of the initial kinetics of histone removal upon heparin concentration , ( 2 ) analysis of DNA and histones in the fractions obtained from differential sedimentation of heparin treated nuclei , and ( 3 ) analysis of the products from heparin treated nuclei by equilibrium centrifugation in metrizamide density gradients . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Amino acid composition and tryptic fingerprints of rye ( Secal cereale ) H 1 , H2B ( PH 1 ) , and H2A ( PHII ) histones indicate the presence of major differences between these and the corresponding calf or rabbit fractions . ^^^ In addition to variations for other amino acids , fraction H 1 from rye contains twice as much arginine as the corresponding animal fraction ; the plant H2B ( PHI ) and H2A ( PHII ) histones show lysine to arginine ratios greater than those of their animal counterparts . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The specific activities of the [ 14C ] acetate label in histones H2A , H2B , H 3 , and H 4 in monomer particles are similar to their respective values in whole chromatin . ^^^ Starch gel electrophoresis of histone fractions derived from monomeric nucleosomes revealed the presence of monoacetylated and phosphorylated species of H2A , monoacetylated species of H2B and H 3 , and mono , di , tri , and tetraacetylated species of H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The results from monitoring the [ 14c ] lysine in each protein indicate that , in the nucleosome classes ( monomer through tetramer ) , the molar ratios of histones H2A , H2B , H 3 , and H 4 are equivalent . ^^^ Furthermore , in each population of the nucleosome classes monomer through tetramer , it was possible to demonstrate that this histone unit ( H2A + H2B + H 3 + H 4 ) is present , on the average , in the amount of two for monomers , four for dimers , six for trimers , and eight for tetramers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Pea histones H2A and H2B . ^^^ Pea histone 2 group , a mixture of H2A and H2B obtained by chromatography on an ion exchange resin , was further fractionated by carboxymethylcellulose chromatography and purified by Bio Gel P 60 chromatography . ^^^ Their chromatographic behaviors and gel electrophoretic mobilities of single bands differed significantly from those of calf H2A and H2B . ^^^ The sequence of H2A may vary in much the same way as that of H2B , as suggested by the similar extent of differences in their amino acid compositions . ^^^ It is thus assumed that the amino terminal regions , at least , of H2A and H2B histones are variable in evolution provided that they remain basic enough to bind DNA , whereas the middle and carboxy terminal hydrophobic regions of H2A , H2B , H 3 , and H 4 should be conserved to ensure precise histone core formation inside the repeated units of chromatin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The proteins found in the isolated deoxyribonucleoprotein 5 . 0 S RNA complex are total amount of both H 4 and H 3 histone , about 20 % of nonhistone protein and about 50 % of both H2a and H2b histone found in the original chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four histones H2A , H2B , H 3 and H 4 complex and form dimers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We propose that the five mRNAs designated a e in order of decreasing electrophoretic mobility code for the histones H 4 , H2A , H2B , H 3 , and H1 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By this procedure , the order of the mRNA sequences on the histone DNA was found to be a , c , d , b , e ( Gross et al . , 1976a ) , and hence of the protein coding sequences H 4 , H2B , H 3 , H2A , and H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Transcription therefore proceeds in the gene cluster in the direction H 4 leads to H2B leads to H 3 leads to H2A leads to H1 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Polylysine , polyarginine , and histones H 1 , H2A , H2B , and H 3 inhibit Giemsa staining and chromosome banding by binding to DNA and preventing side stacking of the positively charged thiazine dyes to the negatively charged phosphate groups on DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The secondary structures of the histones , H 1 , H2A , H2B , H 3 , and H 4 have been predicted utilizing the predictive scheme of Chou and Fasman ( Biochemistry 13 : 211 , 222 [ 1974 ] ) and a new set of conformational parameters based on the 10 ray data of 29 protein structures . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone H 1 was extracted with 0 . 5 M PO 4 1 M urea ; H 1 , H2A , and H2B were extracted with 0 . 8 M PO 4 2 M urea ; and all histones were removed with 0 . 8 M PO 4 5 . 3 M urea . ^^^ It was , however , observed that the dissociated rye histones H2A and H2B were unstable in these buffers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Exhaustive digestion of a complex containing the four histones H2A , H2B , H 3 , and H 4 yields a DNA fragment pattern very similar to that of whole chromatin . ^^^ The only other combinations of histones capable of inducing chromatin like DNA organization are H2A / H2B / H4 and those mixtures containing both H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The subsequent extraction of H2A and H2B produces a 14 % increase in the binding , and the removal of H 3 and H 4 , another 54 % increase . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We propose that the basic unit of chromatin is constructed of two isologously paired heterotypic protein tetramers each containing one molecule of H2A , H2B , H 3 , and H 4 histone . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In a protein synthesis system in vitro the RNA fraction directed the synthesis of the histones H 4 , H2A , H2B , H 3 and , possibly , of H 1 protein . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Homologous whole histone from calf thymus was adsorbed on Sepharose 4B columns with covalently coupled histone fractions H2a , H2b , H 3 or H 4 in 0 . 01 M phosphate buffer , pH 6 . 7 1 M NaCl . ^^^ Electrophoretic analysis has shown that the different columns exhibit selective affinity to the histone fractions : the H2b column to histone H2b and H2a ( with only weak affinity to histones H 3 and H 4 ) , the H2a column to histones H2b and H 3 ( moderate affinity to histone H2b ) , and the H 4 column to histone H 3 , H 4 and H2b ( weak affinity to histone H2a ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Aliquots of the stored monomers have been subfractionated by dialysis against 0 . 1 M KCl buffers into a soluble fraction containing equimolar amounts of H 4 , H 3 , H2A , H2B associated with a DNA fragment of approximately 130 140 nucleotide pairs , and a precipitated fraction containing all of the histones including H 5 and H 1 associated with DNA fragments . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This paper describes : ( a ) a two column method for the resolution of whole histone from calf thymus into its five main components ( H 1 , H2a , H2b , H 3 and H 4 ) , ( b ) a rapid one step procedure for the isolation of the H 3 fraction from whole histone , ( c ) an alternative one step procedure for the resolution of H 3 and H2a ( which co elute during gel exclusion chromatography on Biogel P 60 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We suggest that the histones can be divided into three groups with decreasing hydrophobic properties : H 3 , H2a greater than H 4 , H2b greater than H1 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The extent of chemical acetylation of histones H2a , H2b , H 3 , and H 4 required for the increase of template activity of the chromatin is within that which can be achieved enzymatically in the cell . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
With intact nuclei , the distribution of incorporated [ 14C ] acetate in the various histones was similar to that observed in vivo ; the arginine rich histones H 3 and H 4 showed the highest specific activities , and lower amounts of label were detected in histones H2a and H2b . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2a , H2b , H 3 , and H 4 form a tetrameric complex in solutions of high salt . ^^^ In 2 M NaCl , histones H2b , H2a , H 3 , and H 4 form a heterotypic tetrameric complex made up of one chain of each histone . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 1 , H2A , H2B , and protamine are not methylated . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Such a pattern , with resolution similar to that of H 1 depleted chromatin , is readily attainable by recombining histones H2A + H2B + H 3 + H 4 with DNA using a salt gradient dialysis method . ^^^ The presence of a third histone , either H2A or H2B in the H 3 + H 4 recombination mixture tends to distort the recognised low angle pattern . ^^^ It is concluded that the histone pair H 3 + H 4 is essential for the formation of a regular higher order structure in chromatin , although for a complete structural development the presence of H2A + H2B is also required . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Irradiation of reconstituted nucleohistone containing only H2A , H2B and DNA also yields the H2A H2B dimer . ^^^ The cross linking event is sensitive to the conformation of the H2A H2B pair since the histones must be bound to DNA for maximum cross linking specificity at low ionic strength . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Purified histones H 1 , H2A , H2B , H 3 and H 4 from rabbit marrow nuclei showed no unusual amino acid compositions . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
For the synthesis of these covalent hybrid molecules , we used a population of histones H 1 , H2A , H2B , H 3 , and H 4 from calf thymus and polyadenylic acid with an average chain length of up to 260 280 bases , representing the size of poly ( A ) tails from mature mRNAs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Acetylations and phosphorylations markedly affect the charge densities of these domains whereas ubiquitination adds a bulky globular protein , ubiquitin , to lysines in the C terminal tails of H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A polyspecific human monoclonal ( auto ) antibody , isolated from a patient in the acute phase of infectious mononucleosis , was found to react with all subfractions ( H 1 , H2A , H2B , H 3 and H 4 ) of histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Located 5 ' to both H2A and H2B is the 26 bp sequence , GGTCATGTGACTCTAATACCGCGCTG . ^^^ Additional 10 bp conserved sequences , CAGCGGGCGC , are present only upstream from the H2A and H2B genes . ^^^ Short repetitive DNA sequence elements are present in the spacer sequences between the H2A and H 3 genes and the H2B and H 4 gene . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones b and c , the counterparts of H2A and H2B , were more resistant . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Oligoclonality of the antibody response and recognition of a determinant composed of histones H2A , H2B , and DNA . ^^^ These antibodies do not react significantly with DNA or individual histones , but bind strongly to the histone H2A H2B dimer and even more strongly to the H2A H2B DNA complex . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B of the sea urchin embryo have been resolved by new methods into components that are synthesized at different stages of development . ^^^ One form of H2A and one form of H2B are synthesized only during the period from fertilization to the blastula stage . ^^^ Subsequently , two other types of H2A and H2B molecules are synthesized . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone H2A , H2B , and H 1 specific proteinases tightly associated with histones were shown to be present in rat thymus nuclei . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Enhanced stability of histone octamers from plant nucleosomes : role of H2A and H2B histones . ^^^ Gel filtration and sedimentation studies have previously established that the vertebrate animal core histone octamer is in equilibrium with an ( H 3 H4 ) 2 tetramer and an H2A H2B dimer [ Eickbush , T . ^^^ When vertebrate animal histone octamers are subjected to gel filtration in 2 M NaCl , a trailing peak of H2A H2B dimer can be clearly resolved from the main octamer peak . ^^^ When the plant octamer is subjected to the identical procedure , there is no trailing peak of H2A H2B dimer , but rather a single peak containing the octamer . ^^^ A sampling across the octamer peak from leading to trailing edge shows no change in the ratio of H2A H2B to ( H 3 H4 ) 2 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Four histones , a , b , c , d from procyclic Trypanosoma brucei brucei , which show similarities with the amino acid composition of the core histones H 3 , H2A , H2B and H 4 , were isolated and cleaved with Endoproteinase Glu C . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The dissociation of the T . b . brucei histones was compared with that of their higher eukaryote counterparts H 3 , H2A , H2B and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The DNA sequence of one of the clusters reveals six genes in the contiguous arrangement of H2B , H 1 , H 3 , H 4 , H2B and H2A . ^^^ The order of genes within the second cluster is H 3 , H 4 , H2B and H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
First , the transcriptional defects in strains lacking these SNF genes are suppressed by a deletion of one of the two sets of genes encoding histones H2A and H2B , ( hta 1 htb1 ) delta . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The H2B GL 105 gene is paired with a functional H2A histone gene and this H2A / H2B gene pair is separated by a bidirectionally transcribed intergenic promoter region containing consensus TATA and CCAAT boxes and an OTF 1 element . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The activity of the normal complex on UVC irradiated DNA was increased approximately 2 . 5 and 1 . 5 fold over activity on damaged naked DNA , when core ( histones H2A , H2B , H 3 , H 4 ) and total ( core+histone H 1 ) nucleosomal DNA , respectively , was used . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
After analysed with SDS PAGE , the histone could be separated into H 1 , H 3 , H2B , H2A and H 4 fractions . ^^^ In 28 SLE patients , the positive rates of anti H2B , H 1 , H 3 , H2A and H 4 were 78 . 6 % , 60 . 7 % , 50 . 0 % , 35 . 7 % and 7 . 1 % respectively . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Antibodies to each of the individual histones ( H 1 , H2A , H2B , H 3 , H 4 ) occurred with similar frequencies except for IgG and IgA antibodies to H 4 , which were uncommon . ^^^ In contrast , antibodies to the histone complexes H2A H2B and H 3 H4 were detected in only two serum samples and thus do not appear to be a feature of SLE . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The antibody bound chromatin was enriched in multiply acetylated forms of the core histones H 3 , H 4 and H2B , but not in ubiquitinated H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In this article we show that sperm decondensation is accompanied by loss of two sperm specific basic proteins ( 10 and Y ) and gain of histones H2A and H2B , resulting in nucleosome formation . ^^^ Purified nucleoplasmin alone removes 10 and Y and assembles purified H2A and H2B on decondensing sperm chromatin , forming nucleosome cores . ^^^ Immunodepletion of nucleoplasmin from extract prevents removal of 10 and Y and addition of H2A and H2B , while adding back nucleoplasmin restores decondensation and 10 and Y removal . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In order to approach and clarify the effect of poly ( ADP ribose ) on the nucleosomal structure , polynucleosomes from calf thymus were incubated with long poly ( ADP ribose ) chains prepared in vitro and examined by ELISA with antibodies directed against the five individual histones H 1 , H2A , H2B , H 3 and H 4 as well as against two synthetic peptides in residues 1 25 of H2B and 130 135 of H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Since the conservatism of the core histones ( H2A , H2B , H 3 , and H 4 ) is clearly illustrated by comparative sequence analyses , the data shown here demonstrates that T . cruzi histone H 4 is the most divergent reported . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
During vegetative growth , macronuclear histones H2A and H2B and micronuclear H2A are ubiquitinated . ^^^ Very soon after the second postzygotic division ( approximately 8 h ) when new macronuclei begin to synthesize RNA , ubiquitinated H2B and polyubiquitinated H2A are present . ^^^ During later stages of conjugation ( 15 h ) , the level of polyubiquitinated H2A decreases , while ubiquitinated H2B increases in developing new macronuclei , attaining levels of ubiquitinated H2B approaching that of parental macronuclei . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
No correlation was found , however , between the proposed genomic subtypes H1A , H1B , H2A and H2B , and the genital or nongenital origin of the HSV strains . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Large amounts of histones , H 1 , H2A , H2B , H 3 , and H 4 , were observed in total extracts of T 4 lymphocytes and derived cell lines infected with the human immunodeficiency virus ( HIV ) type 1 or type 2 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
All of the histone subfractions ( H 1 , H2A , H2B , H 3 and H 4 ) induced histamine release from mast cells in a Ca free medium and , as in the case of histone mixture , the amount of histamine release was reduced by addition of Ca2+ . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The core histones , H 3 , H2B , H2A , and H 4 were reconstituted with polyglutamic acid ( a deposition vehicle ) and added to closed circular DNAs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The antibody response of rabbits immunized with a total histone mixture containing randomly coiled H1 / H5 , H2A , H2B , H 3 and H 4 devoid of DNA was investigated in direct and competitive ELISA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The strength of protein 15 . 2 kDa binding to ds DNA was the same as that of the eukaryotic histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A cytoplasmic histone acetyltransferase B , specific for histone H 4 , and two nuclear acetyltransferases A 1 and A 2 were identified ; A 1 acetylates all core histones with a preference for H 3 and H2A , whereas A 2 is specific for H 3 and also slightly for H2B . ^^^ The order of acetylated substrate preference is H2A much greater than H 3 greater than or equal to H 4 greater than H2B for HD 1 and H 3 greater than H2A greater than H 4 for HD 2 , respectively ; HD 2 is inactive with H2B as substrate . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using a highly stringent binding assay in combination with DNA sequencing gels , we found that ADP ribose polymers bind noncovalently to a specific group of chromatin proteins , i . e . , histones H 1 , H2A , H2B , H 3 , and H 4 and protamine . ^^^ When the interactions of variously sized linear and branched polymer molecules with individual histone species were tested , the hierarchies of binding were branched polymers greater than long , linear polymers greater than short , linear polymers and H 1 greater than H2A greater than H2B = H 3 greater than H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
During the chase period , H 3 , H 4 tetramers dissociated from the H2A , H2B dimers to re form nucleosomes with the corresponding nondense histones synthesized during the chase period . ^^^ These data suggest that the prereplicative nucleosomes are dissolved during advancement of the replication fork with release of associated histones in the form of the H 3 , H 4 tetramers and H2A , H2B dimers . ^^^ Experiments that involve density labeling of cells in the presence of actinomycin D indicate that the dynamic exchange of H2A , H2B that has been previously described [ Jackson , 5 . ( 1987 ) Biochemistry 26 , 2315 2324 ] is partially dependent on RNA polymerase movement . ^^^ The low level of deposition that is observed has characteristics similar to the deposition of uH2A and uH2B , and it is proposed that conjugation of H2A and H2B by ubiquitin occurs when these proteins are in a free pool within the nucleus . ^^^ The new H 3 , H 4 tetramers and new H2A , H2B dimers when prevented from depositing are not stable . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These acid soluble tightly bound proteins are , in terms of apparent molecular mass and immunoreactivity , quite similar to the ' typical ' , loosely bound histones , and , similarly to their ' loosely bound ' counterparts , they can be subdivided in distinct H 1 , H2A , H2B , H 3 and H 4 like components , the ' digested matrix ' being however characterized by the absence of tightly bound H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Electrophoresis was accomplished in 9 min , separating a whole histone preparation into its components in the following order of decreasing mobility : ( MHP ) H 3 , H 1 ( major variant ) , H 1 ( minor variant ) , ( LHP ) H 3 , ( MHP ) H2A ( major variant ) , ( LHP ) H2A , H 4 , H2B and ( MHP ) H2A ( minor variant ) , where MHP is the more hydrophobic component and LHP is the less hydrophobic component . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A novel divergently transcribed human histone H2A / H2B gene pair . ^^^ A genomic clone containing a novel closely linked human histone H2A / H2B gene pair has been isolated and sequenced along with extensive 5 ' and 3 ' flanking regions . ^^^ The nucleotide sequences are 84 % and 87 % homologous to the coding regions of a human genomic H2A and H2B gene , respectively . ^^^ A comparison of the nucleotide derived amino acid sequences shows that the histone H2A protein corresponds to the human H2A . 1 subtype , whereas the H2B histone gene predicts an H2B protein sequence which is almost identical to the histone H2B . 2 variant from human and bovine obtained by direct protein sequencing . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Several histone gene repeating units containing the genes for histones H 1 , H2A , H2B , H 3 and H 4 were isolated by screening a genomic DNA library from the midge Chironomus thummi ssp . thummi . ^^^ This repeating unit contains one copy of each of the five histone genes in the order and orientation mean value of H 3 H4 mean value of H2A H2B H 1 mean value of . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A / H2B inhibit the interaction of transcription factor IIIA with the Xenopus borealis somatic 5S RNA gene in a nucleosome . ^^^ A Xenopus borealis somatic 5S RNA gene was assembled with either the complete octamer of histones , ( H2A / H2B / H3 / H4 ) 2 , or the ( H3 / H4 ) 2 tetramer of histones that comprises the central protein kernel of the nucleosome . ^^^ Thus , the presence of histones H2A and H2B in the 5S nucleosome significantly inhibits the interaction of TFIIIA with its cognate binding site within the 5S RNA gene . ^^^ We propose that either the depletion of histones H2A and H2B from preexisting nucleosomes or the staged assembly of chromatin after replication in which a tetramer of histones H3 / H4 associates with DNA before histones H2A / H2B will facilitate the binding of transcription factors to their cognate DNA sequences . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Localization of the H2A and H2B histone segments interacting with DNA using DNA protein crosslinking ] . ^^^ Histones ' H2A and H2B peptidic points which interact with nucleosomal DNA have been identified by using the methods of DNA protein covalent cross linking . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
RAD 6 differed from its putative E 2 ( 20k ) homolog in exhibiting simple saturation behavior in the kinetics of histone conjugation and in being unable to distinguish kinetically between core histones H2A and H2B , yielding identical values of kcat ( 1 . 9 min 1 ) and Km ( 20 microM ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the second step , this replicated precursor is converted to mature chromatin by the addition of histones H2A and H2B in a reaction that can occur after DNA replication . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone antibodies have been obtained by immunizing rabbits with histones H 1 , H2A , H2B , H 3 , H 4 and triacetylated H 4 , uncomplexed to RNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Whereas ADP ribosylation of H2A and H2B is sensitive to inhibition by 3 methoxybenzamide , as with most other nuclear acceptor proteins , the modification of H 3 and H 4 is not inhibited . ^^^ Cleavage experiments with hydroxylamine indicate a carboxylate ester type ADP ribose protein bond for H2A and H2B and arginine linked ADP ribose residues for H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Protein kinase p 62 phosphorylates enolase , tubulin and calpactin 1 as well as model substrates in the series : histone H 5 greater than poly ( G , T ) n greater than or equal to histone H2A greater than poly ( G , A , T ) n , histone H 4 greater than caseins , histones H 1 and H2B , poly ( G , A , L , T ) n . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The Tigriopus H 3 H4 histone gene pair is clustered with one H2A and two H2B histone genes on a 15 kb genomic Bam H 1 fragment . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It seems likely that the requirement for the presence of EDTA during the renaturation process is correlated to its ability to induce a fairly stable ordered conformation of the histones , although this effect could also be shown with the ' inactive ' H2a , H2b and H 3 components , and was instead less evident with histone H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The GC motif , possessing mirror symmetry , interacts with two ubiquitously identifiable complexes ( S and S 2 ) ; the PEA 3 motif interacts with a ubiquitous ( H 1 ) and a tissue specific ( H 3 ) complex ; the H 2 ( an AP 1 like ) motif interacts also with a ubiquitous ( H2a ) and a tissue specific ( H2b ) complex . ^^^ Mutational analysis and correlation of the presence of defined complexes with the ETS 2 mRNA levels indicate that the S , S 2 , H 1 , and H2b complexes have positive effects on ETS 2 transcription , whereas the H 3 and H2a have negative effects . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The results presented in this paper also suggest that the dimers ( H2A , H2B ) act as a lock , which prevents transmission of conformational alterations from a linker to nucleosome core DNA . ^^^ The histone core dissociation as well as ( H2A , H2B ) dimer displacement are discussed in the light of their possible participation in the eukaryotic genome activation . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Approximately 50 % of H2b , a splicing variant differing from H2a by a five amino acid deletion , can be transported to the cell surface , and the rest appears to be degraded by the same pathway as H2a , both when expressed alone in fibroblasts and together with H 1 in HepG 2 cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition , SAP binding to histones H2A , H2B , H 3 and H 4 was detected , whereas CRP bound only to H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This result means that a single ( H 3 H4 ) 2 histone tetramer can fold approximately 146 bp of DNA with the same positioning as the complete octamer but that a region near the pseudo dyad is only weakly protected against micrococcal nuclease attack in the absence of histones H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Total histone and histone fractions H 1 , H2a , H2b , H 3 , H 4 were prepared from calf thymus and dissolved in phosphate buffered saline ( PBS ) pH 7 . 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These histone H 1 genes are dispersed individually in the genome , apart from the previously described clusters of core histone genes ( H2A , H2B , H 3 and H 4 ) , which probably all encode non polyadenylated mRNAs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two types of cDNAs encoding the H 2 subunit of the human asialoglycoprotein receptor had been cloned , differing only by the presence ( H2a ) or absence ( H2b ) of a segment of 15 base pairs ( bp ) , encoding five amino acids ( Glu Gly His Arg Gly ) immediately carboxylterminal ( exoplasmic ) to the single membrane spanning segment . ^^^ When a virion packaged retroviral vector containing H2a cDNA infected 3T3 cells , 70 % of the resulting clones expressed H2b and 30 % H2a . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Calculation of relatedness on the basis of differences in amino acid composition corroborates the conclusion of molecular distinction between the lectin , histones H2A and H2B , and the fibroblast growth factor as well as angiogenin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Changes in the structure of this active chromatin dependent on the presence of exogeneous Mg2+ ATP or on the addition of a mixture of histones H2A and H2B are shown to lead to the selective repression of Xenopus 5S RNA genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We previously demonstrated that CRP binding to chromatin is dependent on the presence of histone H 1 , despite the fact that CRP binds to purified individual histones H2A and H2B , as well as to H 1 . ^^^ CRP binding to the H2A H2B dimer and ( H 3 H4 ) 2 tetramer was demonstrated and these reactions were inhibited by phosphocholine . ^^^ However , no binding to the subnucleosome complexes ( H2A H2B ) DNA and ( H 3 H4 ) 2 DNA was seen . ^^^ However , binding to core particles could be mediated by differentially exposed determinants on H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Interestingly , each of the newly synthesized variants of histones H 3 , H2B , and H2A was found to deposit simultaneously . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The two genes share 300 bp of 5 ' upstream region with respective H2B genes : somatic H2A with somatic H2B and testis specific TH2A with testis specific TH2B gene . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Enzyme A 1 acetylates H2A in chicken nucleosomes , although it is specific for yeast free H2B ; histone acetyltransferase A 2 is highly specific for H 3 , and histone acetyltransferase A 3 preparations acetylate both H 3 and H 4 in nucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Not only histone H 1 but also histones H2A , H2B and H 3 from calf thymus inhibited AC activity . ^^^ These results indicate that the AC inhibitor in the pancreatic cancer extract is histone H1b or H1d and histones H2A , H2B and H 3 also have an AC inhibitory activity . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the presence of 0 . 2 M NaCl , the addition of the pairs H2A , H2B or H 3 , H 4 or the four core histones to nucleosome core particles produces a decrease in the intensity of the core particle band and the appearance of aggregated material at the top of the gel , indicating that all these histone oligomers are able to associate with nucleosomes . ^^^ Additional electrophoretic results , together with second dimension analysis of histone composition and fluorescence and solubility studies , indicate that H2A , H2B , H 3 , H 4 , and the four core histones can migrate spontaneously from the aggregated nucleosomes containing excess histones to free core DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have previously reported that the binding of ethidium bromide to the nucleosome core particle results in a stepwise dissociation of the structure which involves the initial release of one copy each of H2A and H2B ( McMurray & van Holde , 1986 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Treatment of yeast nucleosomal particles with the amino group reagent dimethylmaleic anhydride is accompanied by selective release of histones H2A and H2B . ^^^ H2B deficient nucleosomal cores are similar in the two kinds of particles : the histone octamer blocks RNA synthesis , this block being eliminated in part by the partial loss of histones H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This effect is specific to histone H 4 in that large deletions in the N termini of H2A , H2B , and H 3 do not similarly decrease induction . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This process is followed by the release , in the greater than 30 kDa cell free supernatant fraction , of core histones ( H2A , H2B , H 3 , H 4 ) and low molecular weight DNA ( approx 160 bp ) constituents of nucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two single copy sequences flanking two different human histone gene clusters were used as probes to map these clusters by in situ hybridization . pFF435B , a unique sequence subclone derived from a lambda genomic clone ( lambda HHG 55 ) containing H2A , H2B , H 3 , and H 4 genes , mapped to chromosome 1q21 ( chi 2 = 120 . 99 , P less than 0 . 001 ) . pST519E , a single copy sequence derived from a lambda genomic clone ( lambda HHG 17 ) containing only H 3 and H 4 genes , mapped to chromosome 6p21 ( chi 2 = 112 . 62 , P less than 0 . 001 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
RAD 6 protein is a ubiquitin conjugating enzyme ( E 2 ) that has been shown to attach multiple molecules of ubiquitin to histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Previous studies have shown that ubiquitinated ( u ) histone H2B and , to a lesser extent , mono and polyubiquitinated histone H2A are enriched in transcriptionally active gene enriched chromatin fractions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
N1 complex supplemented with histone H2A H2B dimers and DNA topoisomerase 1 forms nucleosomes on circular DNA under physiological conditions . ^^^ Histone H2B and the three oocyte specific H2A proteins were purified as free histones . ^^^ N1 complexes is enhanced by free histone H2A H2B dimers , which by themselves do not supercoil DNA . ^^^ Nucleosomes containing 146 base pair DNA and the four histones are formed when histones H2A and H2B complement the reaction . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Nucleosomes containing the four histones H 3 , H 4 , H2A and H2B but lacking histone H 1 are readily assembled on the DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Moreover , ubiquitinated species of histones H2A and H2B and hyperacetylated species of H 4 and H2B , which are complexed to active DNA , are labelled . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When similar data based on the amino acid sequences of the histones H 1 , H2A , H2B and H 3 are taken into account , the average estimate is 1 . 1 + / 0 . 1 billion years . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The cleavage of the C terminal domains of H 1 , H2A and H2B , and of the N terminal tail of H 3 led to a decondensation of chromatin fibres , indicated by increases in electric birefringence and orientational relaxation times . ^^^ The degradation of the other terminal regions of histones H 3 , H2A and H2B resulted in the appearance of hinge points between nucleosomes without alteration of the overall orientation of polynucleosome chains . ^^^ Despite the loss of all the basic domains of H 1 , H 3 , H2A and H2B , no significant change in DNA protein interactions occurred , suggesting that most of these protease accessible regions interact weakly , if at all , with DNA in chromatin . ^^^ The data suggest that histone histone interactions between H 1 and core histone domains play a central role in stabilizing the chromatin fibres , and cuts in H 3 , H2A and H2B as well as H 1 , seem necessary for chromatin expansion . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
High levels of acetylation of lysines in the amino terminal domains of all four core histones , H2A , H2B , H 3 , and H 4 , have been shown to reduce the linking number change per nucleosome core particle in reconstituted minichromosomes ( Norton , 5 . ^^^ Because there is evidence to suggest that the acetylations of H 3 and H 4 have functions that are distinct from those of H2A and H2B , we have determined the nucleosome core particle linking number change in minichromosomes containing fully acetylated H 3 and H 4 and very low levels of acetylation in H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two mRNAs ( for H2B and H 3 ) are transcribed from one DNA strand and the two other histone mRNAs ( for H2A and H 4 ) from the other strand as is the case for some insects and certain vertebrates . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A yeast H2A H2B promoter can be regulated by changes in histone gene copy number . ^^^ The two divergently transcribed H2A H2B gene pairs in yeast are differentially regulated as a function of the copy number of histone genes . ^^^ The level of H2A plus H2B protein in the cell may signal the response to histone gene copy number , suggesting that transcription of the HTA 1 HTB1 locus can be autogenously regulated . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B are modified by ubiquitination of specific lysine residues in higher and lower eucaryotes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The nucleotide sequences of two non allelic histone H2A H2B gene loci of the green alga Volvox carteri have been determined . ^^^ Each locus contains a divergently arranged H2A H2B gene pair . ^^^ The encoded proteins differ in one ( H2A ) and 16 positions ( H2B ) , respectively . ^^^ Transcription in one gene locus was shown to initiate 48 bp upstream from H2A and 59 bp upstream from H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the cell cycle of the budding yeast Saccharomyces cerevisiae , expression of the histone genes H2A and H2B of the TRT 1 and TRT 2 loci is regulated by the performance of `` start , ' ' the step that also regulates the cell cycle . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
To increase understanding of the significance of this modification we have studied the specificity of site utilisation in the monoacetyl , diacetyl and triacetyl forms of histones H 3 , H 4 and H2B ( histone H2A has only a single modification site ) , using pig thymus and HeLa cells as the source of histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The terminal domains of H 1 , the NH 2 terminal tail of H 3 and the carboxy terminal ends of histones H2A and H2B were found to be cleaved already at the early stages of proteolysis and this led to a decondensation of polynucleosomal chains . ^^^ Thereafter the C terminal part of H 3 and both NH 2 terminal regions of H2A and H2B became rapidly cleaved , resulting in relative reorientation of swinging nucleosomes or partially unfolded segments . ^^^ Unexpectedly , this removal of tails of H 1 , H2B , H2A and H 3 is not accompanied by significant changes in DNA protein interactions resulting in free oriented DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition to a previously described histone ( H ) encoding H 4 gene [ Meier et al . , Nucleic Acids Res . 17 ( 1989 ) 795 ] , the mouse genomic DNA clone 53 contains two H 3 genes , one functional and one partially deleted H2A gene , and one H2B gene . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The binding of antinuclear antibody positive juvenile arthritis ( JA ) sera to bovine thymus histones H 1 , H2A , H2B , H 3 , and H 4 was studied by an enzyme linked immunosorbent assay . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Epitopes recognized by the third type consisted of complexes of dsDNA and H2A + H2B or of dsDNA and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The H2A , H2B and H 3 genes are unique in the A . nidulans genome . ^^^ The H2B gene , like the H2A gene , is interrupted by three introns , the H 3 and H4 . 1 gene are each interrupted by two introns and the H4 . 2 gene contains one intron . ^^^ The H2A and H2B genes are arranged as a gene pair separated by approximately 600 bp and are divergently transcribed . ^^^ The H4 . 2 gene is not closely linked to either the H2A H2B or H 3 H4 . 1 gene pairs . ^^^ This karyotype was used to assign the H 3 H4 . 1 gene pair and the H4 . 2 gene to linkage group 8 and the H2A H2B gene pair to either linkage group 3 or 6 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The kinase utilized the MBP as the major substrate with little or no phosphorylation of histones ( H 1 , H2A , or H2B ) , casein , phosvitin , protamine , or 40 S ribosomal proteins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
As substrate a reconstituted nucleosomal system was utilized consisting of a plasmid DNA and either core ( H2A , H2B , H 3 , H 4 ) , or total ( core plus H 1 ) histones from normal or XPA cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The assembly activity cofractionates with two histone complexes composed of the acidic protein N1 / N2 in complex with histones H 3 and H 4 , and nucleoplasmin in complex with histones H2B and H2A . ^^^ This indicates that it is not the synchronous action of both complexes which is required for nucleosome assembly , but that their cooperative action can be resolved into two steps : deposition of H 3 and H 4 from the N1 / N2 complexes onto the DNA and completion of nucleosome core formation by addition of H2B and H2A from the nucleoplasmin complexes . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have determined that the protein LMW DNA complexes responsible for these effects are nucleosomal constituents of chromatin , since the mitogenically active fractions of these cell free supernatants contain the constituents of core histones ( H 3 , H2A , H2B , H 4 ) together with LMW DNA ( 140 180 bp ) , and since the immunoproliferative effects of these cell free supernatants could be mimicked by various other nucleoprotein preparations ( including calf thymus and chicken erythrocyte nucleosomes ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Determination of the DNA sequence of the gene encoding HMf 2 ( hmfB ) has revealed that over 30 % of the amino acid residues in HMf 2 are conserved in the consensus sequences derived for eucaryal histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The relative labeling rates for the acetylated histones were in order of decreasing incorporation ; H3 . 2 greater than H3 . 1 greater than H 4 greater than H2B . 1 greater than H2A . 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The relative molar reactivity for mouse liver histones in vivo was H 3 greater than H 1 greater than H2b greater than H 4 greater than H2a . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These regions contained one ( H2A and H2B ) , or two ( H 3 and H 4 ) well defined DNAase 1 cutting sites , or two poorly defined sites ( H 1 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two sperm H2B , two late H2B , and three late H2A variant cDNA clones were isolated and characterized by DNA sequence analysis . ^^^ The different late H2A and H2B mRNAs are present in as few as 200 copies in the egg and each accumulate to 3 5 10 10 ( 5 ) molecules in the gastrula embryo . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
ELISA and immunoblotting techniques showed that antibodies from both patient groups bound all classes of intact histone : H 1 greater than H2B greater than H2A greater than H 3 greater than H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
No cross reactivity of the antibodies with other histones including H 1 , H2A , H2B , H 3 , H 4 , and rat liver histone H 1 ( 0 ) was observed . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Of the nuclear proteins , the content of core histones ( H2A , H2B , H 3 , and H 4 ) was fundamentally similar among all the specimens , whereas the content of H 1 histone was different from one specimen to another . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These AP endonuclease activities were studied on non nucleosomal and nucleosomal plasmid pWT830 / pBR322 DNA which had been reconstituted with core ( H2A , H2B , H 3 , H 4 ) or total ( core plus H 1 ) histones from normal or XPA cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A markedly different pattern of reactivity was present in sera of patients with procainamide ( Pr ) induced lupus in which antibodies to H2A , H2B , and the H2A H2B complex had strong fragment activity . ^^^ Interestingly , recognition of trypsin resistant fragments was also noted in a small number of SLE sera that contained antibodies to the H2A H2B complex . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The sperm H2B 1 gene , normally inactive in development , was 80 times less well expressed than the early H2A gene in transformed blastulae . ^^^ A fusion gene with the early H2A promoter linked to the structural sperm H2B gene was , however , efficiently transcribed suggesting that all essential information for an early expression pattern is contained within the 5 ' region of the early H2A gene . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The common determinants were not shared by any of the H 1 series , nor by H2A , H2B , protein A 24 or a wide range of natural and synthetic products . 5 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , we have found a number of novel H2a , H2b , and H 3 poly ( A ) + RNA species in avian haploid round spermatids . ^^^ The spermatid specific H2a and H2b 0 . 8 kilobase RNAs are transcribed from a subset of the replication dependent H2a and H2b gene families . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We studied the poly ( ADP ribosylation ) of the major classes of histones in response to DNA breakage induced by an extracellular burst of active oxygen ( AO ) or the alkylating agent N methyl N ' nitrosoguandine ( MNNG ) in the immortalized human keratinocytes HaCa T using a combination of affinity chromatography on phenylboronate resin and immunoblotting with polyclonal antibodies against histones H 1 , H2B , H2A , H 3 , and H 4 . ^^^ Several histones were constitutively poly ( ADP ribosylated ) in untreated controls : 0 . 03 % of H2A , 0 . 04 0 . 06 % of H2B , and 0 . 04 % of H3 . 1 carried at least one poly ( ADPR ) chain of undetermined length . ^^^ The extent of substitution 30 min after exposure to AO generated by 50 micrograms / mL xanthine and 5 micrograms / mL xanthine oxidase was 0 . 8 % for A 24 greater than 0 . 3 % for H 4 greater than 0 . 1 % for H3 . 1 = 0 . 1 % for H3 . 2 = 0 . 1 % for H2B . 2 greater than 0 . 09 % for H2A . ^^^ Within 60 min , poly ( ADPR ) substitution had decreased to control levels for H 3 and H 4 and below control levels for H2A and H2B . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Many of the sera reacted with four terminal peptides ( residues 1 21 and 130 135 of H 3 , 1 29 of H 4 and 1 25 of H2B ) while fewer reacted with internal peptides ( residues 65 85 of H2A and 40 55 of H 3 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
SDS polyacrylamide gel electrophoresis showed that histones H 1 , H2A , and H2B dissociated from cell nuclei in the presence of 1 M NaCl , resulting in increasing accessibility of DNA to the fluorochrome . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The mononucleosomes released from the bleomycin treated nuclei contained the core histones H2A , H2B , H 3 , and H 4 ; while HMG 1 and HMG 2 proteins , in addition to the core histones , were detected in the mononucleosomes obtained by micrococcal nuclease digestion of nuclei . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The anti whole histones antibodies which are less frequent in diffuse sclerosis / acrosclerosis ( 35 . 7 % ) than in SLE ( 41 . 3 % ) recognize especially H 1 and H2A in the first diseases , H 1 and H2B in SLE and H 1 and H 3 in RA . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Within the histone gene cluster described , H 3 and H 4 genes are duplicated ( with inverted orientation ) , whereas one H 1 gene is flanked by single H2A and H2B genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When DNA replication was inhibited with aphidicolin both CS H2A and CS H2B accumulated in male pronuclei at the same rate as in the control culture , whereas accumulation of H 3 and H 4 histones was reduced . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When cross linking is restricted to the central , `` globular ' ' regions of histones , it drops most for H 1 , to an intermediate extent for H2A and H2B , and least for H 3 and H 4 in transcriptionally active versus transcriptionally silent chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Five histone genes ( H 1 , H2A , H2B , H 3 , H 4 ) were identified in a repeating unit and several sequence blocks common to the five histone genes were found in the 5 ' and 3 ' regions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have recently demonstrated that trout liver histones H2A , H2B , and H2A . ^^^ None of the other nucleosomal histones ( H2B , H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Lysine rich histones ( H 1 , H2A and H2B ) , various polycations , and proteolytic fragments of purified H 3 or H 4 were all inactive . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Four histone genes from one cluster ( H 3 , H 4 , H2B , H2A ) and two histone genes from another ( H 4 and H2A ) were analyzed . ^^^ The C . elegans core histone genes are organized as divergently transcribed pairs of H 3 H4 and H2A H2B and contain 5 ' conserved sequence elements in the shared spacer regions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The minichromosomes assembled de novo by CAF 1 consist of correctly spaced nucleosomes containing the four core histones H2A , H2B , H 3 , and H 4 , which are supplied in a soluble form by the cytosol replication extract . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
E 2 ( 23 kDa ) recognized both core and linker histones with an apparent order of preference of H2A greater than or equal to H 1 greater than H2B greater than H 3 greater than H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The nematode Caenorhabditis elegans expresses one species of H2A and one species of H 4 molecules , at least two species of H 1 ( H1 . 1 , H1 . 2 ) , two species of H2B ( H2B . 1 , H2B . 2 ) and 2 4 species of H 3 ( H3 . 1 and H3 . 3 and an unassigned Ile / Leu microheterogeneity in H 3 ) . ^^^ The degree of post translational modification , however , particularly acetylation of H2A , H2B and H 3 histone species , was reduced at old age . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The efficiency of crosslinking , however , showed such a dependence : whilst the yield of crosslinks was similar in total and H 1 depleted chromatin , in core particles the efficiency was 3 4 times lower for H2A , H2B and H 4 and 10 12 times lower for H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These salt soluble chromatin fragments are enriched in hyperacetylated species of H 4 and H2B , ubiquitinated and polyubiquitinated species of H2A and H2B and are depleted of linker histones H 1 and H 5 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This specific variant pattern changed upon ageing as a result of accumulation of replacement variants so that in adult animals both chromatin preparations exhibited similar pattern for H2A and H2B , while the difference in the profile of H 3 variants was preserved . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A survey of inbred strains of mice showed H2b and H2q mice as high responders , H2d as an intermediate responder , H2k as a low responder and H2a as a non responder . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The enzyme specific for yeast H2B acetylates chicken erythrocyte H2A , rather than H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
RAD 6 protein has been previously shown to be a ubiquitin conjugating ( E 2 ) enzyme that attaches ubiquitin to histones H2A and H2B in vitro . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The binding of the purified [ 1 , 2 , 4 3H ] triamcinolone acetonide receptor complexes to calf thymus DNA cellulose was increased markedly in a dose dependent manner by low concentrations of a whole histone mixture ( H2A , H2B , H 3 , H 4 , and H 1 from calf thymus ) , but this high level of binding decreased at higher concentrations of the histone mixture . ^^^ The binding of receptor complexes to DNA cellulose was enhanced greatly by histones H 4 and H 3 and slightly by histone H2A , was not affected by histone H2B , and was inhibited by histone H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
All five major histones ( H 1 , H2a , H2b , H 3 , and H 4 ) were among the nuclear proteins cross linked to DNA . ^^^ The formation of this dimer is particularly sensitive to MSA release on hydrolysis of MDMS because , in the presence of MSA , HCHO preferentially cross linked an H2a H2b dimer and a 48 kDa non histone protein to DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Secondary structures of histones H 1 , H2A , H2B , H 3 , H 4 and H 5 have been calculated by the computer program ALB based on a molecular theory of protein secondary structure . ^^^ For each of the core histones ( H2A , H2B , H 3 , H 4 ) one long alpha helix and several short ones have been predicted . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The fraction of bovine thymus and chicken erythrocyte chromatin enriched in transcriptionally active gene sequences was enriched in mono and polyubiquitinated species of histones H2A , H2B , and H2A . ^^^ Histones H2A and H2B were ubiquitinated in the transcriptionally active Tetrahymena macronucleus , with monoubiquitinated ( u ) H2B being the predominant ubiquitinated histone species . ^^^ Ubiquitinated forms of histones H2A and H2B were found in transcriptionally inert micronuclei , but at lower levels than seen in macronuclear histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Above this salt concentration , histone release is not so cooperative ; H2A and H2B are released from the DNA more readily than are H 3 and H 4 . ^^^ This results in an apparently heterogeneous population of ( H2A , H2B ) depleted intermediate species sedimenting at rates between that of free DNA and that of intact core particles . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chemical cross linking has allowed us to identify H 1 , H2A and H2B as the histones contacted by HMG 1 and HMG 2 upon reconstitution . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A , H2B , H 3 and H 5 were shown to be concerned with inhibitors of heparin and its complexes responsible for nonenzymatic fibrinolytic effect on unstabilized fibrin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Anti histone subfraction ( H 1 , H2A , H2B , H 3 , H 4 ) activity was determined in sera containing anti total histone antibodies . ^^^ There was a higher preponderance for antibodies to H 1 , H2A , H2B in SLE . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Z , H2A , H2B , H 3 ( . 2 , day 1 ; . 3 , days 3 and 4 ) , H4 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Antibodies to histone subfractions H 1 , H2a , H2b , H 3 , and H 4 were also observed in all liver disorders investigated ( in 22 32 % of patients ) H 1 and H 3 being the prominent fractions involved . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Antibodies to the core histones ( H2A and H2B ) were found in 1 of 21 pauciarticular JRA sera , 1 of 19 polyarticular JRA sera , and no systemic JRA sera . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Under optimal conditions at 27 degrees C , relaxed DNA plasmids are efficiently assembled into supercoiled minichromosomes with the endogenous histones H 3 , H 4 , H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We characterized one of the H 1 genes which was linked to an H2a , an H2b , an H 3 , and an H 4 histone gene . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The 5 ' region of a cell cycle regulated human H 1 histone gene appears to contain at least six promoter DNA elements that are shared with some , but not all human core ( H2A , H2B , H 3 and H 4 ) histone genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Among other protein substrates , TPK strongly phosphorylates histones H 5 and H2a , weakly phosphorylates histones H2b , H 4 and H 1 but does not phosphorylate protamine , casein , vinculin or angiotensin 2 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have identified the yeast histone locus HTB 1 HTB1 , encoding histones H2A and H2B , as a suppressor of solo delta insertion mutations that inhibit adjacent gene expression . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The `` lability ' ' fraction of histones H2A H2B is revealed . ^^^ In these fractions histones H2B have many modified forms and they are not included into octamer ( H 3 , H 4 , H2A , H2B ) 2 . ^^^ The `` lability ' ' fraction of histones H2A H2B is stated to be very significant in the activated and repressed chromatin structure . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When produced in Escherichia coli , the CDC 34 gene product catalyzed the covalent attachment of ubiquitin to histones H2A and H2B in vitro , demonstrating that the CDC 34 protein is another distinct member of the family of ubiquitin conjugating enzymes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Apparently homogeneous preparations of the E 2 isozymes were tested for their ability to catalyze the E 3 independent conjugation of ubiquitin to linker histone H 1 and core histones H2A , H2B , H 3 , and H 4 in the presence of catalytic amounts of E 1 . ^^^ Rate studies for the monoubiquitination of H2A and H2B revealed that : 1 ) E 2 ( 14kDa ) catalyzed a second order reaction with respect to histone concentration ; 2 ) E 2 ( 32kDa ) mediated ligation proceeded by hyperbolic kinetics , yielding Km values of 2 . 8 and 12 microM for H2A and H2B , respectively ; and 3 ) E 2 ( 20kDa ) exhibited complex kinetics composed of both second order and hyperbolic pathways , the latter having Km values of 0 . 83 and 1 . 5 microM for H2A and H2B , respectively . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Ubiquitinated derivatives of histones H2A and H2B , in which the carboxyl terminus of ubiquitin is joined to epsilon amino groups of specific lysine residues of each histone , occur in vivo . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Based on a restriction site map of the clone and the subcloned sequences which hybridize to the histone mRNAs , the order of the core histone genes in the clone is shown to be H 3 H2A H2B H 4 . ^^^ The transcript lengths of H2A , H2B , H 3 , and H 4 mRNAs are approximately 464 , 438 , 494 , and 397 bases , respectively . ^^^ The S 1 nuclease mapping also demonstrates that H2A and H 4 are transcribed from one DNA strand while H2B and H 3 are transcribed from the other strand . ^^^ In the tandem repeat , the genes are organized so that transcription of the H2A H2B and H 3 H4 gene pairs is divergent . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The same sera contained antibodies reacting with double stranded DNA , whereas no antibodies against H2A , H2B , and H 4 were detected . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
As a way of studying nucleosome assembly and maintenance in Saccharomyces cerevisiae , mutants bearing deletions or duplications of the genes encoding histones H2A and H2B were analyzed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here we demonstrate that the protein encoded by the RAD 6 gene , previously shown to be a ubiquitin conjugating ( E 2 ) enzyme , multiply ubiquitinates histones H2A and H2B efficiently to give products containing as many as seven or more molecules of ubiquitin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition to the response to the three histones H 1 , H2B , and H 3 reminiscent of idiopathic systemic lupus erythematosus , antibody to histone H2A predominates in some drug induced cases . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chromatin reorganization during emergence of malignant Friend tumors : early changes in H2A and H2B variants and nucleosome repeat length . ^^^ These changes were reflected in a decrease in two major histone variants , H2A . 1 and H2B . 2 , with a coordinate increase in histone variants , H2A . 2 and H2B . 1 , and a changing nucleosome repeat length ( NRL ) . ^^^ There was no obvious relationship among the NRL , H2A , and H2B histone variant values . ^^^ Cell lines derived in vitro also showed directional changes in the H2A and H2B variants similar to those of their tumor cell parents , but with different kinetics . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It was calculated that these proteins turn over with half lives of 21 . 6 days for H2A , 13 . 8 days for H2B , 43 . 3 days for H 3 , and 138 . 6 days for H 4 . ^^^ In some experiments the turnover rates of the variants of H2A , H2B , and H 3 were compared . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Purified activated GRC were found to have much higher affinity for histones H 3 and H 4 ( arginine rich histones ) than for histones H2A and H2B ( slightly lysine rich histones ) and to have negligible affinity for histone H 1 ( lysine rich histone ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Competition experiments with various histones ( H 1 , H2A , H2B , H 3 , and H 4 ) indicated that ASTP bound to the arginine rich histones H 3 and H 4 , with preference for H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Repetitive DNA sequences , derived from the human beta globin gene cluster , were mapped within a series of human genomic DNA segments containing core ( H2A , H2B , H 3 and H 4 ) and H 1 histone genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When IF proteins are titrated with a mixture of core histones and linker histone H 1 , in general the latter is totally excluded from complexation and in the adducts formed the moderately arginine rich histones H2A and H2B are progressively replaced by the very arginine rich histones H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
At low NAD concentrations the enzyme can poly ( ADP ribosyl ) ate histones H 1 and H 1 , H2A , A2A , and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition to histones H2A and H2B , two histones ( designated H 3 and H 4 ) which are similar in their electrophoretic mobilities to histones H 3 and H 4 but have lower isoelectric pH values are enriched in immuno precipitates obtained with nucleoplasmin antibodies . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
E 3 independent Ub transfer to the small , basic proteins histones H2A and H2B , and cytochrome c , is also observed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast , H2B , H2A , H 1 and protein A 24 were poly ADP ribosylated in the nuclear chromatin of the same cells . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In microplasmodia , uH2A amounts to 7 % of H2A and uH2B amounts to 6 % of H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two of these cloned DNA fragments , MM 221 and MM 291 , located on chromosome 13 , code for H 3 , H2b and H2a histone mRNAs , which are expressed at low levels in cultured mouse cells and fetal mice . ^^^ Amino acid substitutions in some H 3 , H2a and H2b proteins are detected as internal cleavages in the S 1 nuclease maps . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Regions hypersensitive to an endogenous nuclease and DNAase 1 appear in the 5 ' flanking regions of genes for H2A , H2B and H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The ubiquitinated adducts of all H2A and H2B variants can be recognised on two dimensional electrophoresis as forming a pattern similar to that of the unmodified species . uH2A amounts to 12 14 % of total H2A . ^^^ All H2A variants appear to be equally modified . uH2B amounts to 1 2 % of total H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The cutting sites have been mapped ; there are very sensitive sites close to the cap site for H 1 , H2A , H2B , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The core histone genes of a 3 . 4 kbp Bgl 2 segment cloned in the plasmid pDv3 / 3 . 4 have the same order as the D . melanogaster core histone genes in the plasmid cDm 500 : H2B H 3 H4 H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
No long range repeat was evident , but there were preferred associations , such as H 1 genes with paired , divergently transcribed H2A H2B genes and H 3 H4 associations . ^^^ However , there were exceptions , and even when associations such as H 1 H2A H2B we maintained , the order of those genes within a cluster may not have been . ^^^ Despite the dispersed nature of chicken histone genes , the number of each type was approximately equal , being represented as follows : 6 H 1 , 10 H2A , 8 H2B , 10 H 3 , and 8 H4 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Organization , primary structure , and evolution of histone H2A and H2B genes of the fission yeast Schizosaccharomyces pombe . ^^^ The histone H2A and H2B genes of the fission yeast Schizosaccharomyces pombe were cloned and sequenced . ^^^ Southern blot and sequence analyses showed that , unlike other eucaryotes , Saccharomyces cerevisiae included , S . pombe has unequal numbers of these genes , containing two histone H2A genes ( H2A alpha and beta ) and only one H2B gene ( H2B alpha ) per haploid genome . ^^^ H2A and H2B alpha are adjacent to each other and are divergently transcribed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Characterization of two nonallelic pairs of late histone H2A and H2B genes of the sea urchin : differential regulation in the embryo and tissue specific expression in the adult . ^^^ Two nonallelic pairs of late H2A and H2B genes of the sea urchin Psammechinus miliaris were isolated on two different cosmid clones . ^^^ The genes of cosmid PmL 1 are separated by 11 kilobases of DNA and code for the late H2A 2 and H2B 2 variants . ^^^ The genes of clone PmL 2 are divergently transcribed with 1 , 060 base pairs of intergenic spacer DNA and code for novel variants of the H2A 2 and H2B 2 type . ^^^ The mRNAs of the H2A and H2B genes of cosmid PmL 1 reach their maximal levels early in the mesenchyme blastula embryo , whereas the transcripts of both genes of clone PmL 2 accumulate maximally only later in the pluteus larva . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The susceptibilities of histones were in the order of relative degradation rate : H2B , H2A , and H 3 . ^^^ The major peptide fragments released by CANP from H2A , H2B , and H 3 were isolated and the cleavage sites were determined . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Ubiquitinated ( u ) species of histones H2A and H2B were enriched in the nuclease sensitive , low ionic strength , soluble fraction of both chromatins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones of metaphase chromosomes were extensively modified by ADPribosylation , with H2B , H2A and H 4 being predominant acceptors of [ 3H ] adenosine label . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Deletions of the hydrophilic N termini of H2A or H2B do not show this effect on mating . ^^^ These experiments allow us to define a unique H 4 function that is not shared by other histones ( H2A and H2B ) . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The regulatory region defined in this study apparently does not contain consensus sequences similar to those reported for the cell cycle regulated HO endonuclease or for the histone H2A and H2B genes of Saccharomyces cerevisiae . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The complete amino acid sequence of a single H 1 histone of the protozoan Tetrahymena pyriformis was determined , following previous determinations of the sequences of histones H2B , H2A , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Acetate is incorporated into all core histones during S phase , but only into H2A and H2B during G 2 period . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
H2A consists of three major variants , and H2B consists of two major and four minor variants . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , an H2B beta galactosidase fusion protein containing both this point mutation and the H2A interaction domain of H2B was nuclear localized . ^^^ These results suggest that H2A and H2B may be cotransported to the nucleus as a heterodimer . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The relative degree of acetylation of molecules was H 1 1 . 0 , H 5 0 . 81 , H2B 0 . 48 , H2A 0 . 24 , H 3 0 . 24 , H 4 0 . 16 . ^^^ Histones H2A , H2B and H 5 appear to be labelled at random along the entire polypeptide chain , while histones H 3 and H 4 are labelled almost exclusively in the first 30 residues from the N terminus . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
With both kinds of particles , 50 % of histones H2A and H2B are released for modification of approximately 35 % of the histone amino groups . ^^^ H2B dimers allows the preparation of nucleosomal particles deficient in one H2A . ^^^ H2B dimer and of the histone hexamers H2A . ^^^ The histones corresponding to the liberated DNA , except H2A and H2B released with dimethylmaleic anhydride , are apparently bound to the DNA containing particles as extra histones . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When DNA synthesis was inhibited , newly synthesized histone accumulated in the soluble fraction , but H2A and H2B continued to complex with chromatin at a significant rate . ^^^ Soluble histone in G 1 cells showed the same differential partitioning of H4 / H3 and H2A / H2B between the soluble and chromatin bound fractions as was found in cycling cells with inhibited DNA synthesis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The electrophoretic mobilities of proteins solubilized with 0 . 4 N H2SO4 from CS , Fe , Mg , and Mn cells are nearly identical and are characteristic of the five histone classes , H 1 , H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The synthesis of histones H2A and H2B continues during the G 2 period , but synthesis of H 4 and H 3 is restricted to the S phase of the cell cycle . ^^^ Experiments with hydroxyurea demonstrated that the synthesis of H 4 and H 3 is completely dependent on unperturbed DNA synthesis , whereas synthesis of H2A and H2B is independent from DNA synthesis during the entire cell cycle . ^^^ This implicates significant differences between the arginine rich histones H 4 and H 3 and the moderately lysine rich histones H2A and H2B with respect to the control mechanisms of their synthesis , the metabolic stability , and the function for chromatin structure . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
CRP bound to H 1 and H2A and to a lesser extent to H2B . ^^^ CRP binding to the H2A H2B complex was observed as well as reactivity with trypsin resistant fragments of H2A , H2B , and H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Transfer of histones between DNA ( H2A , H2B ) and DNA ( H 3 , H 4 ) complexes . ^^^ In non denaturing low ionic strength gels , the titration of core DNA with H2A , H2B produces five well defined bands . ^^^ Quantitative densitometry and cross linking experiments indicate that these bands are due to the successive binding of H2A , H2B dimers to core DNA . ^^^ In gels of higher ionic strength , DNA ( H2A , H2B ) samples produce an ill defined band , suggesting that the lifetime of the complexes containing H2A , H2B is relatively short . ^^^ However , the low intensity of the free DNA band observed in these gels indicates that most of the DNA is associated with H2A , H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using a newly developed enzyme linked immunosorbent assay , antibodies to histones ( H 1 , H2A , H2B , H 3 and H 4 ) were found in 32 out of 40 rheumatoid arthritis patients with antinuclear antibodies at a titer greater than or equal to 100 as measured by indirect immunofluorescence . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By using a Nucleosil 300 5 C 4 column and a multistep water acetonitrile gradient containing 0 . 1 % trifluoroacetic acid , the HMG 1 and HMG 2 proteins , several H 1 subfractions including H 1 ( 0 ) , H 4 , H2B , two H2A variants and two H 3 subfractions were separated . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Sodium dodecyl sulfate containing polyacrylamide gels were not useful for the fractionation of maize histone classes H2a and H2b , nor for the various subfractions of H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Additionally , antibodies to the individual histones H 1 and H2B , the most exposed histones in chromatin , were more prevalent than antibodies to the remaining histones ( H2A , H 3 , H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Indeed , histone fractions which are most often recognized by the canine antibodies are by order of frequency H 3 , H 4 and H2A , whereas in man this order is H 1 , H2B then H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The proteolyzed histones correspond to four polypeptide fragments which are tentatively assigned to H2A [ 4 129 ] , H2B [ 1 125 ] , H 3 [ 27 135 ] and H 4 [ 18 102 ] on the basis of electrophoretic evidence and the known specificity of clostripain for arginyl residues . ^^^ The latter includes the polypeptide fragments H2A [ 12 129 ] , H2B [ 21 125 ] , H 3 [ 27 135 ] and H 4 [ 20 102 ] . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The human H 1 histone gene FNC 16 resides in a 2 . 7 kb EcoRI fragment present in a histone gene cluster that also contains one copy of each of the core ( H2A , H2B , H 3 , and H 4 ) histone genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Worcel , Cell 37 : 33 41 , 1984 ) , that packages DNA into minichromosomes with regularly spaced nucleosomes containing histones H 3 , H 4 , H2A , and H2B but no histone H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The two gene pairs encoding H2A and H2B play different roles in the Saccharomyces cerevisiae life cycle . ^^^ We have isolated Saccharomyces cerevisiae mutants bearing deletions of one or the other of the two divergently transcribed gene pairs encoding H2A and H2B . ^^^ Deletion of TRT 1 , one of the H2A H2B gene pair sets , affected mitotic growth , sporulation , spore germination , the heat shock response , and exit from the stationary phase ; deletion of TRT 2 , the other H2A H2B gene pair set , had negligible effects on these same processes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
High levels of IgG antibodies to histones H 1 and H2B were detected whereas responses to H2A , H 3 , and H 4 were only marginally elevated above pre GVH levels . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A nucleosomal core particle is composed of two each of histones H2A , H2B , H 3 and H 4 located inside the particle with approximately 47 base pairs ( bp ) of DNA wrapped around the octamer in about 1 . 8 turns of a left handed superhelix . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A hybrid histone octamer was reconstituted from erythrocyte H2A and H2B , avian [ 110 Cys des thio ] histone H 3 and the sea urchin sperm [ 73Cys ] H 4 variant . [ 110Cys Des thio ] histone H 3 was prepared by reaction of natural H 3 with Raney nickel . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , in the ES cells , the content of histones H 1 , H2A , and H2B were reduced by gossypol treatment ( with an inhibition of 50 % , 58 % , and 31 % , respectively ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Conservation of histone H2A / H2B intergene regions : a role for the H2B specific element in divergent transcription . ^^^ The organization and function of potential regulatory elements associated with the promoters of chicken H2A and H2B genes pairs have been examined . ^^^ The intergene regions of six dispersed and divergently transcribed H2A / H2B gene pairs contain several extremely well conserved and spaced blocks of sequence homology . ^^^ Transcription of H2A and H2B genes from wild type and mutant constructs was measured in transient assays by transfection into HeLa cells , and in permanently transformed clonal cell lines . ^^^ This suggested that the H2A / H2B gene pairs contained overlapping promoters . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 3 , H2A and H2B from Sch . pombe migrated almost identically to their respective counterparts from S . cerevisiae as determined by acid / urea gel electrophoresis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Isolated histones from sea urchin sperms , and especially histones H 1 , H2A , H2B and H 3 , were degraded by the nuclear activity . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have studied the limited cleavage of H2a in the H2a : H2b histone dimer by the H2a specific protease under physiological conditions ( neutral pH , 0 . 1 M NaCl ) using a variety of histone DNA reconstitutes as substrates and / or regulators of the partially purified enzyme . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
According to the prediction method based on the necessary requirements of amino acid coding this structure may be localized in the following segments of amino acid sequences of calf thymus histones : H 1 90 112 , H2A 54 76 , H2B 50 72 and 102 124 , H 3 15 37 and 73 95 , H 4 5 27 or 6 28 and 32 54 or 42 64 . ^^^ According to the known experimental data on the secondary structure of histones only the following localizations are possible : H 1 90 112 , H2A 54 76 , H2B 50 72 , H 3 73 95 , H 4 42 64 . ^^^ Using the known experimental data on DNA histone interactions it is possible to suggest that these localizations of structures alpha helix turn alpha helix possible in histones H2A , H2B and H 4 allows them to participate in close or structurally essential interactions of histones with DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have reconstructed nucleosomes from a histone octamer ( H2A , H2B , H 3 , H 4 ) 2 and DNA 146 b . p . or 2 3 thousands b . p . in length . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We suggest that these histones ( HPb 1 and HPb 2 ) correspond to the vertebrate histones H2A and H2B , respectively . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The core histones of 1 . argentinus slightly differ from those of calf thymus in the subfractional composition of histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Western blot analysis using a panel of anti histone antibodies demonstrated the presence of histones H2A , H2B and H 4 in apparently intact form . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By studying the ratio of 3H / 14C , it was indicated that the synthesis of H 1 , H 3 , H2B plus H2A and TP 1 in the RS was reduced by gossypol . ^^^ In the ES , the synthesis of H 1 , H 3 , H2B plus H2A , H 4 plus TP 2 , TP 3 , and TP 1 was reduced by gossypol , the reduction was 33 % , 22 % , 26 % , 14 % , 33 % , and 8 % , respectively . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We show that the major type ( H 1 , H2B , H2A , H 4 , H 3 ) , present at about 60 70 copies per haploid genome ( 1 ) , is tandemly reiterated with a repeat length of 15 kb . ^^^ An isolate of this type had the gene order H 1 , H 4 , H2B , H2A , H 1 ( no H 3 cloned ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Nuclei were isolated and treated with formaldehyde to stabilize the histone histone interactions with a covalent cross link that produces an octameric complex of two each of H 3 , H2B , H2A , and H 4 . ^^^ New H2A , H2B deposited as a dimer and also does not dissociate in subsequent chases . ^^^ On the basis of the new : old ratio in the hybrid octamers , we propose that additional old H2A , H2B from elsewhere in the genome interacts with tetramers of new H 3 , H 4 to form the newly synthesized nucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
All four core histones H2A , H2B , H 3 , H 4 , and the lysine rich histone H 1 are present . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By contrast to histone H 4 , the overall levels of acetylation and the proportions of the different acetylated species of H2A , H2B and H 3 remain unchanged throughout the period examined . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Sequential Edman degradation and carboxypeptidase digestion unambiguously establish that histones H2A , H2B , H 3 and H 4 are selectively cleaved at the carboxyl side of Arg 11 , Lys 20 , Arg 26 and Arg 19 respectively and that the C terminal sequences remain unaffected . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A comparison of the DNase 1 digestion products of the 32P 5 ' end labeled pachytene nucleosome core particles ( containing histones H2A , TH2A , X 2 , H2B , TH2B , H 3 , and H 4 ) and liver nucleosome core particles ( containing somatic histones H2A , H2B , H 3 , and H 4 ) revealed that the cleavage sites that are 30 , 40 , and 110 nucleotides away from the 5 ' end are significantly more accessible in the pachytene core particles than in the liver core particles . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Mouse histone H2A and H2B genes : four functional genes and a pseudogene undergoing gene conversion with a closely linked functional gene . ^^^ The sequence of five mouse histone genes , two H2a and three H2b genes on chromosome 13 has been determined . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It was demonstrated that the existence of supernucleosomal organization leads to a significant decrease of the degradation rate of histones H 1 and H 5 in comparison with histones H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These fractions included three subfractions of linker histones ( H1a , H1b , H 1 ( 0 ) ) , four nucleosomal core histones ( H2A , H2B , H 3 , H 4 ) , and the modified core histone , A 24 ( uH2A ) , comprised of H2A covalently bound to the non histone protein , ubiquitin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
One human histone gene cluster ( lambda HHG 41 ) containing an H 3 and H 4 gene resides only on chromosome 1 , whereas other clusters containing core ( H 3 , H 4 , H2A , and H2B ) alone ( lambda HHG 17 ) or core together with H 1 histone genes ( lambda HHG 415 ) have been assigned to chromosomes 1 , 6 , and 12 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The binding of ethidium bromide to chicken erythrocyte core particles results in a step wise dissociation of the structure that involves the initial release of one copy each of histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using an immunodot assay and an enzyme linked immunosorbent assay ( ELISA ) , sera from patients with liver disease were tested for antibodies to the five individual histones H 1 , H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When either pair of the yeast histone genes H2A and H2B , or H 3 and H 4 was present on high copy number plasmids , both chromosomes 5 and 7 exhibited an increased frequency of chromosome loss . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Yeast histone H2A and H2B amino termini have interchangeable functions . ^^^ The N terminal ends of histones H2B and H2A have very different sequences and rates of evolution . ^^^ However , deletions at the N termini of both H2B and H2A in the same cell are lethal or result in greatly reduced viability . ^^^ Even switching portions of the N termini between H2B and H2A to create two chimeric histone proteins within the same cell has no obvious effect on viability . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
An acid urea polyacrylamide gel with a transverse Triton 10 100 gradient resolved and identified in a single gel at least one type of histone H 4 , two variant forms of histone H2B , two variant forms of histone H 3 , and four variant forms of histone H2A from a crude histone preparation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These are the linker histone ( H 1 ) , consisting of 3 subfractions ( H1a , H1b , H 1 ( 0 ) ; the semi histone uH2A ( A 24 ) ; and the 4 nucleosome core histones ( H2A , H2B , H 3 , H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Deposition of newly synthesized histones : new histones H2A and H2B do not deposit in the same nucleosome with new histones H 3 and H 4 . ^^^ Newly synthesized H 3 and H 4 deposit as a tetramer and are associated with old H2A and H2B . ^^^ Newly synthesized H2A and H2B deposit as a dimer associated with old H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The core histone genes ( H2A , H2B , H 3 and H 4 ) of Caenorhabditis elegans are arranged in approximately 11 dispersed clusters and are not tandemly arrayed in the genome . ^^^ A fourth cluster ( clone BE 9 ) has one copy each of H 3 and H 4 and two copies each of H2A and H2B . ^^^ Hybridization of gene specific probes from sea urchin to C . elegans RNA identifies C . elegans core histone messenger RNAs of sizes similar to sea urchin early stage histone mRNAs ( H2A , H2B , H 3 and H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The interaction of histone ( H2A , H2B ) dimer with DNA : DNA sequence dependence . ^^^ Binding of the histone ( H2A , H2B ) dimer with chicken erythrocyte DNA has been studied by salt titration spectroscopy in equilibrium conditions . ^^^ The circular dichroism of DNA near 275 nm is depressed by the interaction with ( H2A , H2B ) at low concentrations of salt . ^^^ The depression increases with increasing amounts of ( H2A , H2B ) , and reaches a plateau at an ( H2A , H2B ) to DNA ratio of 1 . 5 ( w / w ) , at which one ( H2A , H2B ) dimer occupies 28 base pairs of DNA . ^^^ The fluorescence emission intensity of the tyrosine residues in ( H2A , H2B ) is depressed by the H2A , H2B ) DNA interaction . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The peak near 0 . 95 M NaCl corresponds to the dissociation of the dimer ( H2A , H2B ) from the DNA ( H 3 , H 4 ) complex , as shown by binding experiments of ( H2A , H2B ) to the DNA ( H 3 , H 4 ) complex at the salt concentration near this peak . ^^^ By the assumption of a non co operative model , the binding constant for the chicken erythrocyte ( H2A , H2B ) dimer to the DNA ( H 3 , H 4 ) complex is calculated as 2 . 8 10 10 ( 6 ) M 1 at 1 . 0 M NaCl ( 20 degrees C , pH 7 . 6 ) . ^^^ It is concluded that histones ( H 3 , H 4 ) have a different DNA sequence dependence from histones ( H2A , H2B ) . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
All five histone classes and several subclass species are separated , including two H 1 species , H2B , two H2A species , H 4 , and two H 3 species . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Lysine rich histones H 1 , H2a and H2b were found to accept phosphate during chromatin phosphorylation by cAMP dependent protein kinase . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The other histones of calf thymus also bound Ap4A with affinities decreasing in the order H 4 approximately H 3 greater than H 1 greater than H2b greater than H2a . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We show that core histones are contained in two distinct complexes : H2A and H2B are associated with nucleoplasmin , and H 3 and H 4 are associated with nuclear protein N 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Evolution of late H2A , H2B , and H 4 histone genes of the sea urchin , Strongylocentrotus purpuratus . ^^^ Amino acid sequences derived from nucleotide sequences of late H2A and H2B gistone genes differ substantially from amino acid sequences of their late counterparts . ^^^ A few , however , occur in positions that do not mutate frequently and thus may reflect functional differences between the early and late forms of the H2A and H2B proteins . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This technique has allowed us to study the interaction of HMG 1 and HMG 2 with the core histones , in the form of an H2A 10 H2B dimer and an ( H 3 10 H 4 ) 2 tetramer , for an effective time of crosslinking of less than 1 ms and under very mild conditions . ^^^ With this procedure we found that both HMG 1 and HMG 2 interact with H2A 10 H2B and also with ( H 3 10 H 4 ) 2 . ^^^ Results obtained indicate that the domain of HMG 1 and HMG 2 involved in the interaction with H2A 10 H2B histones is the highly acidic C terminal , whereas the N terminal is involved in the interactions with ( H 3 10 H 4 ) 2 histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chicken histone H 4 , labeled at methionine 84 with 1 N pyrenyliodoacetamide , has been incorporated into a nucleosome like particle with core length DNA and unmodified histones H2A , H2B , and H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The interaction between novobiocin and proteins appears to involve arginine residues : histones H 3 and H 4 ( 13 . 5 and 14 mole percent arginine ) are precipitated at lower novobiocin concentrations than histones H2A and H2B ( 9 . 5 and 6 . 5 mole percent arginine ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When the pattern of hydrolysis of poly ( ADP ribosyl ) ated histones was analyzed it was found that poly ( ADP ribose ) attached to histone H2B is more resistant than the polymer attached to histone H 1 or H2A or protein A 24 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Antihistone antibodies were searched for in autoimmune prone strains of mice : MRL / 1 , MRL / n , PN , and NZB by micro enzyme linked immunosorbent assay ( micro ELISA with total histones or H 1 fraction as antigen ) and immunoblotting using a solution of total histones containing H 1 , H2A , H2B , H 3 , and H 4 . ^^^ Among MRL / 1 mice , the histone fractions best recognized by antihistone antibodies , are , in decreasing order : H 1 , H 3 , H 4 , H2B , and H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The primary sites of cleavage were assigned to Leu 115 of H2a , Val 18 or Gln 22 of H2b , and Leu 10 plus Leu 22 of H 4 . ^^^ These results indicate that the amino terminal 20 30 residues of H2b , H 3 , and H 4 and the amino and carboxyl terminal approximately 12 residues of H2a , in toto , interact weakly if at all with DNA of isolated nucleosome cores . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Enzyme linked immunosorbent assay ( ELISA ) and immunoblotting were used to define comparatively the frequency of antibodies to total histones and different histone fractions H 1 , H2A , H2B , H 3 , and H 4 in 16 patients with idiopathic systemic lupus erythematosus . ^^^ H 1 and H2B showed the most prominent antigenic properties ; H 3 ' s were weaker , while antibodies to H2A and H 4 were rarely detected and only with the more sensitive ELISA on microtiter plates . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chicken histone H 4 , labeled separately at Met 84 with N [ [ ( iodoacetyl ) amino ] ethyl ] 5 naphthylamine 1 sulfonic acid and 5 ( iodoacetamido ) fluorescein , was reassociated with unlabeled histones H2A , H2B , and H 3 and 146 base pairs of DNA to produce fluorescently labeled nucleosomes having physical characteristics virtually the same as those of native core particles . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This solution contained H 1 and core histones ( H2A , H2B , H 3 and H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The complete amino acid sequence of a main variant , H1b , of human spleen histone H 1 was determined , following previous determinations of human spleen histones H2B , H2A , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We prepared and characterized cDNA clones encoding the sperm specific H2b protein as well as the H2a beta protein found in testis . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Near 0 . 7 M ionic strength the core histones H2A and H2B begin to dissociate from the chromatin , and the opening of the nucleosome cores leads to increasing elongation of the chromatin molecules . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By varying the gradient , trifluoroacetic acid concentration ( 0 . 05 % ) , and flow rate ( 1 . 3 ml / min ) the histones were eluted from the C 4 column in the following order : H 1 ( MHP ) , H 1 ( LHP ) , H2B , H2A ( LHP ) , H 4 , H2A ( MHP ) , H 3 ( LHP ) , and H 3 ( MHP ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Studies were made on the binding mode of the nucleosome assembly protein AP 1 with histones H2A + H2B and / or H 3 + H 4 . ^^^ Histones H2A + H2B bound with AP 1 to form a 7 S complex which contained twice as much AP 1 ( by weight ) as histones . ^^^ The 7 S and 8 S complexes did not form a new complex when mixed , but significant amounts of two histone pairs were assembled into a 12 S complex on mixing the ( H2A + H2B ) AP 1 complex ( 7 S ) with free H 3 + H 4 . ^^^ In contrast , when the ( H 3 + H 4 ) AP 1 complex ( 8 S ) was incubated with free H2A + H2B , almost no assembly occurred , but the 7 S complex of H2A + H2B was newly formed . ^^^ Binding studies by enzyme linked immunosorbent assay showed that AP 1 bound with H2A + H2B faster than with H 3 + H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Z , and H2B , and ubiquitinated ( prefix `` u ' ' ) histones H2A and H2B ( with a significant relative increase of uH2B over uH2A ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Amino acid sequence analysis showed that the components ( HTH alpha and HTH beta ) are identical to histones H2A and H2B , suggesting the possibility that histones might have hitherto unrecognized occurrence and functions . ^^^ Similarities between COOH terminal regions of histones H2A , H2B , and H 3 were noticed , as well as some similarities between NH 2 terminal regions of histones and parts of recognized thymus hormones and related proteins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , these genes are present in different arrangements within each cluster and different H1A , H2A and H2B proteins ( variants ) are encoded by the respective genes of each cluster . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Anti histone antibodies were generated predominantly to histones H 1 , H2A , and H2B , a profile different from that observed in NZB / NZW and MRL lpr / lpr mice . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The entire structures were found to be identical to those of histones H2A and H2B , respectively , without evidence for sub types , proteolytic processings , or other peptide fragments . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The histones of each peak were identified by sodium dodecyl sulfate and Triton / acid / urea gel electrophoresis or amino acid analysis as follows : P 1 , H 1 degrees ; P 2 P5 , four different H 1 variant fractions ; C 1 , H 4 + A 24 ; C 2 , H2B ; C 3 , H2A 10 2 + to one H2A variant ; C 4 , H2A . 1 ; C 5 , H2A . 1 + two H2A variants ; C 6 , H3 . 2 ; C 7 , H3 . 3 ; C 8 , H3 . 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Autoradiography of gel electrophoretograms showed the major increases in radioactivity to be in histone H2A and histone H2B . ^^^ A regulatory role is suggested for the histones H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the presence of the inhibitors , the extent of synthesis relative to the corresponding control was TH 1 10 greater than H 1 greater than TH2B 10 = X 2 = H2A greater than H2B = H 3 greater than H 4 , in which synthesis of the H 4 fraction was about 50 % of control and that of TH 1 10 was 90 95 % of control . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This suggests a symmetrical and rather autonomous arrangement of the histone tetramer ( H 3 , H 4 ) 2 and two dimers ( H2A , H2B ) on the double stranded core DNA : H2A / H3 ( H2A , H2B ) ( H 3 , H 4 ) 2 ( H2B , H2A ) H3 / H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The reconstituted nucleosomes were found to contain [ 3H ] dinitrophenylated histones H2a and H2b but not [ 3H ] dinitrophenylated histones H 3 and H 4 . ^^^ These results demonstrate that histones H2a and H2b contain dinitrofluorobenzene reactive groups that can be modified without destroying their ability to participate in nucleosome formation in vitro . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Some protein peaks were provisionally identified as actin , the core histones H2A , H2B , H 3 , and H 4 , ribosomal proteins , and six keratins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The proportion of histones H2A and H2B removed from chromatin was increased after mechanical of ultrasonic degradation of chromatin at 5 20 fold excess of total extra histone . ^^^ In some histone preparations , the removal of histones H2A and H2B was not detectable at even 200 fold excess of total histone . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The results make it possible to designate Tyr 72 of histone H 1 as a special class of fluorescent tyrosyls whose properties differ from those of tyrosyls of other tryptophane free proteins : RNAase , insulin , core histones H2A , H2B , H 3 , H 4 and some others . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In solutions of intermediate ionic strength ( 0 . 15 M NaCl ) histones H2A and H2B form dimers , however at high salt concentrations ( 2 M NaCl ) they tend to form complexes of higher order , such as tetramers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The distribution of newly synthesized H2A and H2B coincided closely with that of bulk nucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Treatment of nucleosomal particles with dimethylmaleic anhydride , a reagent for protein amino groups , is accompanied by a biphasic release of histones H2A plus H2B ; one H2A . ^^^ H2B dimer , which were complemented with 125I labeled H2A . ^^^ H2B dimer , were treated with the amount of reagent needed to release one of the two H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Irradiation of isolated nuclei or of a complex of histones 2A ( H2A ) and 2B ( H2B ) with ultraviolet light produces a covalent cross link between H2A and H2B . ^^^ Sequence analysis of the peptides isolated from the H2A H2B dimer formed in solution and in nuclei demonstrated that both dimers are produced through the covalent linkage of Tyr 40 of H2B and Pro 26 of H2A . ^^^ Tyrosyl residues proximal to Tyr 40 did not produce a cross link with H2A , thereby indicating that strict conformational parameters are required for production of the H2A H2B cross link . ^^^ We conclude that the precise juxtaposition of Tyr 40 of H2B and Pro 26 of H2A in this region of the H2A / H2B contact site is not altered upon interaction of these histones with H 3 and H 4 ( tetramer ) , DNA , or other chromosomal components during nucleosome assembly . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Exchange of histones H 1 , H2A , and H2B in vivo . ^^^ By two electrophoretic techniques , we demonstrate that histones H 1 , H2A , and H2B synthesized in the presence of hydroxyurea do not merely associate with the surface of the chromatin but instead exchange with preexisting histones so that for the latter two histones there is incorporation into nucleosome structures . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The accessibility to trypsin of `` core ' ' histones within the dimer ( H2A H2B ) , tetramer ( H 3 H4 ) 2 , octamer ( H2A H2B H 3 H4 ) 2 and in chromatin was studied . ^^^ It was shown that the hydrolysis of histones H2A and H2B within the dimer and octamer occurs in essentially the same way . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Binding of HMG 14 non histone protein to histones H2A , H2B , H 1 and DNA in reconstituted chromatin . ^^^ Selective labeling of HMG 14 with photoactivable reversible heterobifunctional reagents has allowed a clear identification of the histones interacting with it ( histones H2A , H2B and H 1 ) . ^^^ These results are not dependent on whether the chromatin samples used were bulk chromatin , mononucleosomes , or core particles ( for H2A and H2B ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The genome of S . pombe has a single , isolated H2A , a pair of H2A H2B and three pairs of H 3 H4 ( one H2B , two H2A and three each of H 3 and H 4 ) . ^^^ This non assorted histone gene organization is distinct from that of the budding yeast which has two pairs of H2A H2B and H 3 H4 . ^^^ Compared with those os S . cerevisiae and human , variable residues were clustered near the NH 2 and COOH terminal regions of H2A and H2B . ^^^ Sequence homologies to the two organisms were roughly the same in H2A ( 79 83 % ) , H 3 ( 92 93 % ) and H 4 ( 91 % ) , but differed in H2B ( 82 % to S . cerevisiae and 68 % to human ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The structural role of histone H2B from sea urchin sperm ( H2Bsp ) has been examined in experiments on reconstitution of chromatin from DNA and core histones taken in three variants : ( 1 ) four core histones from sea urchin sperm ; ( 2 ) four core histones from calf thymus ; ( 3 ) ( H 3 , H 4 , H2A ) from calf thymus and H2Bsp . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chicken erythrocyte chromatin was depleted of histones H 1 , H 5 , H2A and H2B . ^^^ Both micrococcal nuclease and DNase 1 digestion indicate that , unlike core particles , accessible sites occur in the centre of the particle and it is concluded that the ( H3 / H4 ) 4 125 bp DNA particle is not a ' pseudo core particle ' in which the ' extra ' H 3 and H 4 replace H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Tetrameric ( H3 / H4 ) 2 146 base pair DNA and hexameric ( H3 / H4 ) 2 ( H2A / H2B ) 1 146 base pair DNA complexes . ^^^ The tetrameric ( H3 / H4 ) 2 146 base pair ( bp ) DNA and hexameric ( H3 / H4 ) 2 ( H2A / H2B ) 1 146 bp DNA subnucleosomal particles have been prepared by depletion of chicken erythrocyte core particles using 3 or 4 M urea , 250 mM sodium chloride , and a cation exchange resin . ^^^ It is concluded that since the radius of gyration of the DNA in the tetramer particle and its maximum dimension are very close to those of the core particle , no expansion occurs on removal of all the H2A and H2B . ^^^ Optical melting of the hexamer particle shows that each ( H2A / H2B ) 1 dimer of the core particle protects about 22 base pairs of DNA . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It has been found that histone octamer of calf thymus ( H2A H2B H 3 H 4 ) 2 can exist in two structural states ' ' loose ' ' ( 2M NaCl ) and `` compact ' ' one ( 4M NaCl ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast to 12 O tetradecanoylphorbol 13 acetate , the mitogen from pokeweed did not induce stimulation of H2B and H 4 phosphorylation , but did , however , elicit increases in the phosphorylation of histones H 1 , H2A , and H 3 , in parallel with changes in rate of DNA synthesis . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Human autoantibodies that react with both cell nuclei and plasma membranes display specificity for the octamer of histones H2A , H2B , H 3 , and H 4 in high salt . ^^^ In contrast , mononucleosomes selectively depleted of histones H2A and H2B did not inhibit these reactions . ^^^ Immunosedimentation in sucrose density gradients revealed that 125I labeled Fab ' fragments of highly pure 10 ANA formed complexes with the inner histones H2A , H2B , H 3 , and H 4 in 2 M NaCL , but not in 0 . 15 M salt . ^^^ Furthermore , in light of the previous demonstration that the epitope is destroyed by trypsin , it may be localized in the N terminal region of histone H2A or H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Inhibitory compounds include synthetic polypeptides [ polylysine ( D and L ) and polyarginine ] and basic proteins ( protamine , histones H 1 , H2A , H2B , H 3 and H 4 and myelin basic protein ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
There were no significant differences between the purified core histone subfractions ( H2A , H2B , H 3 , and H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Restriction map & partial sequence of a rice DNA fragment carrying histone genes H2A , H2B & H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Cloned human genomic segments containing the core histone genes ( H2A , H2B , H 3 , and H 4 ) , H2A and H2B pseudogenes , and the H 1 gene were prepared . ^^^ Similar studies were carried out with HeLa cells in which EcoRI segments containing the H 4 histone and H2A and H2B pseudogenes were found to replicate during the first half of the S phase . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This variation is identical for both complexes within a long range of ionic strengths , including the interval of 0 . 8 2 M NaCl , under which conditions interactions are known to exist between the tetramer ( H 3 ) 2 ( H 4 ) 2 and the dimer ( H2A ) ( H2B ) . ^^^ Our results are consistent with the view that the overall structure of the tetramer , as well as its conformational changes during complex structuration or denaturation , are not strongly affected by the presence of the dimer ( H2A ) ( H2B ) . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Murine 6050AJ EC cells exposed to sodium butyrate possess hyperacetylated forms of histones H 4 and altered forms of histones H2a and H2b , whereas histones from cells treated with other inducers appear to be unaffected . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The antigen on the DNA nucleoprotein was shown to involve both DNA and histone fraction H2A + H2B and was trypsin sensitive . ^^^ Studies on one representative isolated polyclonal rheumatoid factor demonstrated the same reactivity with DNA histone H2A + H2B as the monoclonal antibody . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Nucleosomes composed of 195 base pairs of DNA associated with histones H2A , H2B , H 3 , and H 4 purified from chicken erythrocyte nuclei were used to elicit antibodies in rabbits . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Yeast histones H2A , H2B , and H 3 were purified using the standard histone purification procedures of differential solubility and exclusion chromatography . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The packaging of the enormous lengths of eukaryotic DNA into the different conformational states of chromosomes is controlled very largely by an equal total mass of the histones , H 1 , H2A , H2B , H 3 and H 4 . ^^^ The N terminal domains of all histones and the C terminal domains of H 1 , H2A and H2B are flexible random coils , while the C terminal regions of H 3 and H 4 and the central regions of H 1 , H2A and H2B are structured . ^^^ Histones H 3 and H 4 are essential for nucleosome structure and interact with DNA to give the nucleus of the nucleosome structure , which is completed by interactions of the conserved structured regions of ( H2A , H2B ) dimers and H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The LE factor binding antigen was virtually completely regained by mixing DNA and the inner histones H2A , H2B , H 3 and H 4 in 2 M NaCl , followed by step dialysis to 0 . 15 M salt . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The fifth component is a new histone that may substitute for H2A and H2B in the nucleosome . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , histone acetylation for proteins H2A + H2B was not effected . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Electrophoretic mobility of H 1 , H2B and H2A histones of grass carp is shown to differ from that of corresponding fraction of calf thymus histones . 3 . ^^^ Comparison of chromatin protein fractions from liver , mature and immature testis and sperm of grass carp has revealed subtle tissue specificity of H2B and H2A histones . 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Staining of purified calf thymus histones H2A , H2B , H 3 , and H 4 by this method is 30 times more sensitive than staining with amido black alone , allowing the detection of each histone and its modified forms down to the nanogram level . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Further analyses using the antibodies in immune precipitations and in antibody labeling of capillary blots on nitrocellulose sheets of calf thymus histone demonstrate that the antibodies are directed against histones and are capable of reacting with H 1 , H2a , H2b , H 3 , and H 4 histones individually . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The rate of silver reduction was determined with different histones by spectrophotometric measurement of colloidal silver stabilized in solution , and the apparent reactivity thus determined was found to be in the decreasing order of H 1 greater than H2B greater than H2A greater than H 3 greater than H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Group 1 consisted of proteins whose phosphorylation is stimulated by TSH [ histones H 1 and H 3 , high mobility group ( HMG ) protein 14 , and the HMG 14 / 17 like protein PS . 3 ] ; group 2 included representatives of a spectrum of proteins whose phosphorylation is unaffected by TSH ( histones H2A , H2B , and H 4 , HMG 17 , the HMG 14 / 17 like protein PS . 2 , and the nonhistone protein AS . 1 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
DNA from Saccharomyces cerevisiae BAS 2 , in which the pBR 322 ura 3 plasmid ( Y1p5 ) is integrated at the yeast histone H2A and H2B locus , was used to generate a cosmid library , using a new cosmid vector ( pTL 5 ) that is ampicillin sensitive and tetracycline resistant . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B show a partial preference and histone H 1 shows no preference for deposition on new DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have investigated , by chemical cross linking , the interaction of the protein HMG 1 with the histone dimer H2A 10 H2B and the histone tetramer ( H 3 10 H 4 ) 2 in free solution . ^^^ In the case of the H2A 10 H2B dimer , the analysis of the patterns of the cross linking products shows the presence of a trimer , ( H2A 10 H2B ) 10 HMG 1 , and of another oligomer of higher molecular weight which also contains H2A 10 H2B and HMG 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Pachytene nuclei were isolated from rat testes by the unit gravity sedimentation technique and contained histone variants H1a , H1t , TH2A , TH2B , and X 2 in addition to the somatic histones H1bde , H1c , H2A , H2B , H 3 , and H 4 . ^^^ While liver core particles contained all the somatic histones H2A , H2B , H 3 , and H 4 , in the pachytene core particles , histone variants TH2A , X 2 , and TH2B had replaced nearly 60 % of the respective somatic histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Moreover , it cross reacts immunologically with histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The 41K protein bound strongly to histones H 1 and H 4 but much more weakly to H2A , H2B and H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Reconstituted NPCs were prepared from SV 40 DNA and the combination fraction of five histones , H 1 , H2A , H2B , H 3 , and H 4 , isolated from the nuclei of permissive ( CV 1 ) or nonpermissive ( BALB / c 3T3 , rat liver , and calf thymus ) cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Four species of histone H 4 and three of histone H 3 occur with no alteration in histones H2A or H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In vitro phosphorylation of histones H 5 , H2A , H2B and of the dimer H2A H2B by a cyclic AMP dependent protein kinase from rat pancreas . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The gene order was found to be H 3 , H 4 , H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In mouse L 1210 cells , both H2B variants are modified , however only to the extent of 1 1 . 5 % compared with about 11 % of H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Interaction of cGMP dependent protein kinase with histones H2A , H2B , H 3 , and H 4 , or poly ( L arginine ) resulted in changes in enzyme conformation such that inactivation of cGMP binding and activation of basal catalytic activity ( assayed without cGMP ) occurred . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The phosphorylated fragment from the NH 2 terminal region of either H2A ( generated by treatment with N bromosuccinimide ) or H2B ( generated by treatment with cyanogen bromide ) was dephosphorylated by the phosphatase , with the rates of dephosphorylation being reduced 3 to 6 fold by Ca2+ in incubations containing CDR . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two total fractions whose electrophoretic mobility corresponded to that of the histones H2a and H2b from calf thymus were prevalent in the spectrum of acid soluble bDNP proteins of gram negative species . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The ubiquitin moieties of the H2A ' s and H2B ' s are found to be in rapid equilibrium with the pool of free ubiquitin , both in dividing cells such as L 1210 and Chinese hamster ovary cells and in nondividing cells such as unstimulated lymphocytes . ^^^ All ubiquitinated histones , including the four H2A variants and the H2B ' s are absent from isolated metaphase chromosomes . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
For that purpose , Southern blots of genomic DNA , that was digested with several restriction enzymes , were hybridized with radioactively labeled DNA fragments from clone X 1 hi 1 ( 14 ) , containing genes for Xenopus histones H2A , H2B , H 3 and H 4 . ^^^ In the DNA of all animals that were screened we found a major repeating unit of 14 kilobasepairs , which contains genes for histones H2A , H2B , H 3 and H 4 ( H 1 not tested ) and is represented up to 30 times in the genome . ^^^ The order of the genes in this major repeating unit is H 4 H 3 H2A H2B . ^^^ H 3 H 4 H2A H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Injection of the antimitotic beta adrenergic agonist isoproterenol led to a temporary decrease in the rate of phosphorylation of H 1 , H2A and H2B immediately after cyclic AMP accumulation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 3 an H2A are heavily labeled while the other histones of the nucleosome core , H2B and H 4 , are devoid of radioactivity . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When DNAs of different average base compositions competed for the binding of purified histone fractions during in vitro reconstitutions in the presence of salt and urea , a decreasing ( A + T ) binding preference was observed following the order H 1 greater than H2B greater than H 5 greater than H2A greater than [ H2A + H2B ] greater than [ H2A + H2B + H 3 + H 4 ] , [ H 1 + ( H2A + H2B + H 3 + H 4 ) 2 ] . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Arginine rich histones H2A , H2B , H 3 and H 4 contain two regions of interaction with cyclic nucleotide dependent protein kinases : a substrate phosphorylation site and a region which noncompetitively inhibits cyclic nucleotide binding to the protein kinases . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Restriction maps of these clones and localization of the genes coding for histones H2A , H2B , H 3 , and H 4 are presented . ^^^ The arrangement of histone genes in the human genome , therefore , appears to be different from that in the sea urchin and Drosophila genomes in which each of the five histone encoding regions ( H 1 , H2A , H2B , H 3 , and H 4 ) is present only once in each tandemly repeated cluster . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The order of observed cross linking , deduced from kinetic experiments , is H 1 + H 5 , H 3 greater than H 4 greater than H2A much greater than H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The amino acid composition of the protein resembled those of the other prokaryotic histone like proteins and also to eukaryotic histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
One of the H2B genes is closely linked , in a divergent arrangement , to an H2A gene , and sequence data suggests that the linked genes share promoter elements . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The results revealed that ( a ) histones H 1 , H2A , and H 3 incorporated significant amounts of label whereas little or no label was associated with histones H2B and H 4 and ( b ) electrophoresis of the histones in the Triton : acid : urea gel system caused labeled histones to have a slower migration than did the corresponding unlabeled histones . ^^^ Additional studies such as incubation of ( + / ) 7 beta , 8 alpha [ 3H ] dihydroxy 9 alpha , 10 alpha epoxy 7 , 8 , 9 , 10 tetrahydrobenzo ( a ) pyrene with nuclei resulted in radioactive labeling of histones H 1 , H2A , H2B , and H 3 and of high mobility group proteins HMG 1 and HMG 2 . ^^^ Under these conditions , negligible amounts of radioactivity were associated with H 4 , while significant labeling of H 1 , H2A , H2B , and H 3 and other nuclear proteins was observed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Minichromosome associated histones H2A and H2B as well as several nonhistone proteins were poly ADP ribosylated by endogenous poly ( ADP ribose ) polymerase . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The correct 5 ' termini of all five histone genes were detected , three ( H2B , H2A and H 3 ) at relatively high levels . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Minor histone 2A variants and ubiquinated forms in the native H2A : H2B dimer . ^^^ Histone octamers from calf thymus were separated into ( H 3 : H 4 ) 2 tetramers and H2A : H2B dimers by chromatography through Sephadex G 100 . ^^^ Z were found to be associated with histone H2B as H2A . ^^^ X : H2B and H2A . ^^^ Ubiquitin adducts of the H2A ' s and H2B were also present in H2A : H2B dimers . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four mouse histone genes ( 2 H 3 genes , an H2b gene and an H2a gene ) present in a cloned 12 . 9 kilobase fragment of DNA have been completely sequenced including both 5 ' and 3 ' flanking regions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Natural macromolecular polycations ( protamine , histones H 1 , H2A , H2B and H 3 ) caused the clustering of influenza and parainfluenza viruses into aggregates heterogeneous in size , as well as a decrease in their hemagglutinating capacity . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The results show , that as in other eukaryotic systems the sponge chromatin contains the core histones ( H2A , H2B , H 3 and H 4 ) and the linker histone ( H 1 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Among histones , H 3 was most active , followed by H2a , H 4 , and H2b , in that order , the lowest activity seen with H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition , the late stage H 3 and H 4 genes are not always tightly clustered together with the H 1 , H2A and H2B genes as they are in early histone genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These genes are present in the order H 1 , H2B , H2A , H 4 and H 3 , and the minimum length of the repeated unit is 16kb . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Treatment with delta 9 THC ( 10 40 microM ) for 10 hr resulted in a concentration dependent decrease in the representation of H2A , H2B , H 3 and H 4 histone mRNAs without a significant inhibitory effect on the levels of ribosomal RNAs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Evidence for a human histone gene cluster containing H2B and H2A pseudogenes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
One antibody ( BWH 1 ) recognized a determinant present in the nucleosome core H2A H2B complex but showed little reactivity with any of the individual histones ( H 1 , H2A , H2B , H 3 , or H 4 ) . ^^^ Antibody MH 1 reacted with H2A , H2B , and H 3 ; antibody MH 2 reacted with H2A , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Few conservative point changes are observed in the central region ( residues 18 118 ) which interacts strongly with histone H2B to form the dimer H2A H2B . 60 % of the H2A molecules were found phosphorylated on the amino terminal residue , N acetyl serine . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By reference to the genetic code the aminoacyl sequence of histones H2A , H 4 , H 3 , H2B and H 1 ( fragment ) were rewritten as the codon sequences . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It acetylates all four core histones in the order : H 4 greater than H2B greater than H2A . 10 fold higher histone acetyltransferase activity is observed for free histones when compared to yeast polynucleosomes as a substrate . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The core of each disk like nucleosome is a wedge shaped protein octamer containing two molecules of each of the four core histones ( H 3 , H 4 , H2A and H2B ) around which two turns of DNA are wound in a left handed superhelix with about 80 base pairs per turn . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Each of the histones , H 1 , H 3 , H2A , H2B , and H 4 , is present in both log and stationary phase +Zn cells and has been characterized according to its electrophoretic mobility and molecular weight . ^^^ In contrast , log phase zinc deficient ( Zn ) cells contain H 1 and H 3 while H2A , H2B , and H 4 are absent . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In vitro exchange of nucleosomal histones H2a and H2b . ^^^ We observed substantial exchange of histones H 1 , H2a , and H2b when the chromatin and exogenous histones were incubated under approximately physiological conditions . ^^^ We have also observed a small amount of exchange of H2a and H2b , as well as a substantial exchange of H 1 , from one chromatin fragment to another . ^^^ Other conditions affecting the exchange of histones H2a and H2b are also reported . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The extract facilitates the closed circular duplex DNA supercoiling in the presence of calf histone fractions H2A , H2B , H 3 and H 4 , and fish protamine but not HI histone . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
As with H 4 , this acetylation probably correlates with chromatin assembly and is not transcription related . ( 4 ) Histone H2B carries no modification in 2h or in 18h embryos , and H2A shows a single modification in 2h embryos and two in 18 h embryos . ^^^ H2B modification is thus not essential either in mitosis or replication , whereas H2A modification is important in one or both processes . ( 5 ) The nucleosomal protein D 2 is equally present in 2h and 18 h embryos . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Therefore , accumulation of CS H2A and CS H2B are temporally correlated with the repeat length transition , whereas replication , normal progression of the cell cycle , and the early histone transitions involving SpH 1 and SpH2B are not . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast , dimethylmaleic anhydride causes release of histones H 1 , H 5 , H2A and H2B and formation of residual particles deficient in these histones but containing an excess of H 3 and H 4 corresponding to the liberated DNA . ^^^ This reconstitution does not occur when the released fraction containing histones H2A and H2B and free DNA is separated from the residual particles . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Contribution of histones H2A and H2B to the folding of nucleosomal DNA . ^^^ We have studied the structural properties of nucleosomal particles deficient in histones H2A and H2B produced by modification of histone amino groups with dimethylmaleic anhydride [ Jordano , J . , Montero , F . , & Palacin , E . ( 1984 ) Biochemistry ( preceding paper in this issue ) ] . ^^^ When regeneration of the modified amino groups of the residual particles takes place in the presence of the complementary fraction containing histones H2A and H2B , but not in its absence , nucleosomal particles with the structural properties of the original nucleosomes are reconstituted . ^^^ Therefore , the structural change observed in the residual particles can be assigned to the lack of histones H2A and H2B and not to the modified amino groups of the histones present in the residual particles . ^^^ The results are consistent with the stabilization by histones H2A and H2B of a DNA length of 50 70 base pairs per nucleosome . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The proteolysis of the chromatin core particle by the arginine specific endopeptidase clostripain yields a new nucleoprotein particle containing an unaltered DNA fragment of about 145 base pairs in length and a protein octameric core made up of twice the four histone fragments H2A , H2B , H 3 and H 4 . ^^^ The histone fragments differ by about 2 3 kd each from the initial histones H2A , H2B , H 3 and H 4 and they correspond to the cleavage of the N terminal part of the sequence ( 20 30 residues ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
They were eluted in the following order : H2B , ( LHP ) H2A , ( MHP ) H2A , H 4 , LHP ( H 3 ) , and ( MHP ) H 3 , ( where LHP and MHP refer to less hydrophobic and more hydrophobic variants ) . ^^^ If the gradient containing 0 . 3 % TFA was interrupted with an isocratic elution at 43 % acetonitrile , the H2B , ( LHP ) H2A , ( MHP ) H2A , and H 4 proteins were completely resolved , thus providing a good preparative method for these proteins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
While A 13 comigrates with histone H2A on NaDodSO 4 polyacrylamide gels and with H2B on acid / urea gels , it can be readily resolved from the histones by Triton / acid / urea Na DodSO 4 two dimensional electrophoresis . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A , H2B , and H 4 and their fragments ( H2A , 1 56 , 1 89 , 73 129 ; H2B , 1 59 , 1 83 ; H 4 , 1 53 , 1 67 , 1 84 , 69 84 , 85 102 ) have been prepared , characterized , and used to reconstitute protein DNA complexes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This complex contained stoichiometrical amounts of the 53 kDa peptide and core histones , and the core histones in this complex were composed of equal amounts of H2A , H2B , H 3 and H 4 histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , the strength of affinity varied in the order H2A greater than H 3 greater than H2B greater than or equal to H 4 much greater than H 1 , being inversely correlated with the ratio of basic / acidic amino acids in these molecules . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In non erythroid cells , a partial extraction of H2A , H2B and H 1 yields H3 / H4 / DNA complexes and particles of unchanged nucleosomal composition . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The expression of genes coding for the four core histones ( H2A , H2B , H 3 , and H 4 ) was studied in tsAF 8 cells . ^^^ This is the first demonstration in a mammalian G 1 specific ts mutant that the expression of H2A , H2B , H 3 , and H 4 histone genes depends on the entry of cells into the S phase of the cell cycle . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Although transcription of H2a , H 3 , and H 4 mRNAs is reduced during heat shock , like H2b mRNA , they are more stable . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
DNA histones H2A , H2B , H 3 and H 4 complex consisted of globular subunits 100 to 150 A in diameter alternating with thin strands , like beads on a string . ^^^ The nuclease digestion pattern of the complexes containing histones H2A , H2B , H 3 and H 4 was regular , similar to that of chromatin , and was disrupted by urea . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It is shown that the rates of synonymous substitutions are quite uniform among the non overlapping genes of phi X 174 and G 4 and among histone genes H 4 , H2B , H 3 and H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
One , MM 531 , contains regions hybridizing specifically to H 3 , H 4 , and H 1 and the other , MM 221 , contains two regions hybridizing specifically to H 3 and single regions complementary to H 4 , H2b , and H2a . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
At lower concentrations , polyarginine , polylysine , protamine , histones H 1 , H2A , H2B and H 3 cause lysis of human erythrocytes , whereas at higher concentrations inner histones are not hemolytic but induce only surface condensation and alterations in the cell shape . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Phosphorylation of H1 / H5 depleted chromatin also altered the degree of exposure of certain H2A epitopes but it did not affect the surface accessibility of residues 1 11 of H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Affinities of the histone classes for polypentosesulphate appeared in the order from greatest to least : H 4 approximately H 3 greater than H2A greater than H2B greater than H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The data obtained allow to draw out Tyr 72 of histone Hl into a special class of fluorescent tyrosyls , that differ in properties from those of other tryptophandevoided proteins : RNAse , insulin and core histones H2A , H2B , H 3 and H4 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones can be classified by their ability to form insoluble complexes with tubulin : H 4 = H 3 greater than H2B = H2A greater than H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 1 , H2a and H2b from different mammalian tissues were loaded on the column and pure variants H1A , H1B , H2a1 , H2a2 , H2b1 and H2b2 were obtained by urea gradient elution . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Electrophoretic analysis revealed that H 1 , H2A , H2B and H 3 migrate as a single protein ; but different from other species , H 4 was resolved into two variants . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The cellular abundance of histone H 1 mRNA was compared with that of core ( H2A , H2B , H 3 , and H 4 ) histone mRNAs as a function of the cell cycle : core and H 1 histone mRNA levels are related both to each other and to the apparent rate of DNA synthesis and are rapidly destabilized after DNA synthesis inhibition . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Thus , there is a rapid increase in the relative amounts of the variants H2A . 1 and H2B . 2 in parallel with the increase in the number of hemoglobin producing cells and the sharp decrease in the growth rate . ^^^ We also present evidence that H2A and H2B histones are synthesized and incorporated into chromatin at a significant rate even when DNA synthesis is inhibited , suggesting turnover of these histones . ^^^ H2A and H2B turnover can be detected directly even in exponentially growing cells . ^^^ H2A . 1 and H2B . 2 have higher turnover rates than H2A . 2 and H2B . 1 , respectively , in exponentially growing cells , a difference which is even more pronounced in induced cells . ^^^ The magnitude of the differential turnover is not sufficient to account for the changes in the histone variant proportions in the short life of induced MEL cells but could explain the slow accumulation of H2A . 2 , H2B . 1 , and H3 . 3 in nondividing adult tissues of the mouse . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Other proteins did not appear to change their relative rates of synthesis , with the exception of a clear decrease in proteins with nominal molecular weights of histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The histone fractions ( identified by their electrophoretic mobilities ) were eluted from the CN column in the following order : H 1 , H2B , ( LHP ) H2A , ( MHP ) H2A , H 4 , ( LHP ) H 3 , and ( MHP ) H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A model is proposed which describes the packing of polypeptide chains of histone molecules in the octamer ( H 3 H 4 H2A H2B ) 2 , and interlocation of DNA and octamer in the nucleosome . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
During proliferation , in vivo labeling with [ 32P ] orthophosphate revealed that all histones except H2b were phosphorylated in the following order of decreasing modification : H 1 a greater than H2a greater than H 1 b greater than H 3 greater than H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Apparently normal nucleosome core particles containing two molecules each of the four core histones in association with 145 base pairs of DNA and a particle containing one molecule each of histones H2A and H2B in association with approximately 40 base pairs of DNA were also generated during nuclease treatment of the histone DNA complexes formed under physiological ionic strength conditions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These species include the ( H2A , H2B ) dimeric complex ( P 1 ) , the ( H2A2 , H2B2 , H 3 , H 4 ) hexameric complex ( P 2 ) and the nucleosome core complex ( P 3 ) . ^^^ Based on histone histone cross linking studies , CD spectra , and thermal denaturation experiments , P 1 is structurally similar to the subnucleosomal ( H2A , H2B ) fragment isolated from nuclease digested chromatin . ^^^ P 1 , P 2 , P 3 , and high salt assembled nucleosome cores can all incorporate ( H2A , H2B ) pairs which have been previously cross linked . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These include a peak containing a compact hexameric complex composed of one pair of ( H 3 , H 4 ) and two pairs of ( H2A , H2B ) ( P 2 ) and a peak containing complexes with the composition and sedimentation properties of nucleosome cores ( P 3 ) . ^^^ The assembly of P 2 is initiated by the binding of an ( H2A , H2B ) pair to the DNA which then directs the placement of an ( H 3 , H 4 ) pair . ^^^ The incorporation of the final ( H2A , H2B ) pair to complete the particle is probably cooperative . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Organization and bidirectional transcription of H2A , H2B and H 4 histone genes in rice embryos . ^^^ With a view to gathering some much needed information on these genes , we studied a rice genomic clone in pBR 322 carrying H2A , H2B and H 4 histone genes on a DNA fragment of 6 . 64 kilobases ( kb ) . ^^^ H2A and H2B histone genes were located at one end of the insert and H 4 gene at the other with a 3 . 1 kb spacer in between . ^^^ This cluster of three histone genes was found to be transcribed in a bidirectional fashion with H2A and H2B genes being encoded by one strand and the H 4 gene by the other . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Individual core histones H 3 , H 4 , H2a and H2b or protamine stabilised the Mn induced Z form and prevented the transition to B DNA normally observed after chelation with EDTA or on dialysis to physiological salt concentrations . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It has been shown that the content of these cations is higher in normal and diseased H 3 , H2B and H 1 fractions and lower in H2A ; however , in the H 4 fraction these metals are not detected . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The purified enzyme is inhibited by cyclic AMP , ADP ribose , naphthylamine , histones H 1 , H2A , H2B , H 3 , polylysine , polyarginine , polyornithine and protamine . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Stimulation of binding to N sites and stabilization of the holoreceptor was effected by histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In this study , analysis of purified histone fractions revealed the in vivo acetylation of histone H2B , the testis histone variant designated TH2B , and two or more of the histone H2A variants . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
While the rate of synthesis of whole cell and histone protein ( H2a , H2b , H 3 , and H 4 ) and DNA chain elongation recovered by 6 h after cell heating , total precursor incorporation into DNA was only 0 . 4 of control levels . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We show that tyrosines 37 , 40 , and 42 of H2B are protected from iodination in intact core particles , as expected since these tyrosines lie within the H2B H2A binding site . ^^^ In contrast , iodination of tyrosines 83 and 121 of H2B , as well as iodination of the tyrosines of H2A , increases the stability of the histone octamer core . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the presence of the core histones , the enzyme catalyzes the acetylation reaction in the order H 3 greater than H 4 greater than H2B greater than H2A ; the order for histones bound in nucleosome core particles is H 4 greater than H2B greater than H 3 greater than H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The cellular abundance of H2A , H2B , H 3 and H 4 histone mRNA sequences was determined prior to and at various times after stimulation of non dividing human diploid fibroblasts to proliferate . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The histones H 3 , H 4 and probably H2A are similar to those from calf thymus or sea urchin sperm , but the putative H2B appears to have a very high molecular mass ( about 20 kDa ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Cloning of rice DNA & identification of the cloned H2A , H2B & H 4 histone genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The 6S fraction contained H2A , H2B , and A 24 proteins , and the 10S fraction contained four kinds of core histones in equal amounts . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Finally , in contrast to the H2b , H 3 and H 4 mRNAs encoded within clones pHh 4A / pHh4C , pHh5B and pHu4A , respectively , the H2a mRNA encoded by Hh5G is not present in human placental RNA . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones were eluted from the columns in the following order : H 1 , H2B , ( LHP ) H2A , ( MHP ) H2A , H 4 , ( LHP ) H 3 , and ( MHP ) H 3 ( where LHP and MHP refer to the less hydrophobic and more hydrophobic histone variants ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Neutron scattering studies of the H2a H2b and ( H 3 H4 ) 2 histone complexes . ^^^ Neutron scattering experiments have shown that both the ( H 3 H4 ) 2 and H2a H2b histone complexes are quite asymmetric in solution . ^^^ The H2a H2b dimer , on the other hand , is an elongated structure . ^^^ A contrast matching experiment done with 50 % deuterated H2b and undeuterated H2a in the reconstituted dimer showed that these two histones must each be rather elongated within the complex and are not just confined to one end . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The presence of H2A , H2B , H 3 , and H 4 genes in this same 15 kilobase fragment indicates that mammalian core and H 1 histone genes are clustered . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The interactions of fibronectin with unfractionated histone and histone subfractions ( H 1 , H2A + H 3 , H2B and H 4 ) were studied under physiological conditions by laser nephelometry . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We also observe significant amounts of phosphate label associated with micronuclear H2A , H2B , and H 4 and each of the micronuclear H 1 like molecules , alpha , beta and gamma . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Relaxation of chromatin structure upon removal of histones H2A and H2B . ^^^ Modification of chromatin from chicken erythrocytes with dimethylmaleic anhydride is accompanied by its solubilization and the dissociation of histones H 1 , H 5 , H2A and H2B . ^^^ In addition to the effects produced by the lack of histones H 1 and H 5 , both techniques show a substantial relaxation of chromatin structure induced by the loss of histones H2A and H2B , which appear to play an important role in the superhelical folding of DNA . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The dimers have been assigned on the basis of other evidence as being of two kinds , ( H2A H2B ) and ( H 3 H4 ) . ^^^ In particular , the tetramer ( H 4 H3 ) ( H 3 H4 ) is in close contact with the central part of the DNA , but significant contacts are seen also between the histones H 3 and the extremities of the super helix , thus explaining the stability of a nucleosome like particle depleted of H2A and H2B . ^^^ Significant departures from the molecular 2 fold axis of symmetry occur in the relative arrangements of the two ( H2A H2B ) dimers . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
H2A and H2B acetylation is functionally distinct from H 3 and H 4 acetylation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The relative rates of digestion of histones in nucleosome cores by this protease were H 3 greater than H2b greater than H 4 much greater than H2a . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Fusions containing the entire spacer region in which divergent transcription of the H2A and H2B genes is initiated result in low level constitutive synthesis of beta galactosidase ( beta D galactoside galactohydrolase , EC 3 . 2 . 1 . 23 ) in yeast . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone H2A subtypes associate interchangeably in vivo with histone H2B subtypes . ^^^ The yeast Saccharomyces cerevisiae contains two primary sequence subtypes of histone H2B ( H2B1 and H2B2 ) and of H2A ( H2A1 and H2A2 ) . ^^^ Because H2A protein interacts in the nucleosome with H2B , we wished to determine whether specific H2A subtypes must interact with specific H2B subtypes . ^^^ By combining these H2A mutations with the H2B mutations obtained previously , we show that all combinations of H2A and H2B subtypes produce viable cells . ^^^ From these genetic experiments and electrophoretic analysis of the histone proteins of these mutants we conclude that the H2A subtypes can associate interchangeably with the H2B subtypes . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Drosophila melanogaster embryo factor capable of supercoiling circular covalently closed DNA in the presence of core histones H2a , H2b , H 3 , H 4 or protamine ] . ^^^ The Mg2+ dependent factor capable of introducing the superhelical turns into circular closed DNA in the presence of core histones H2a , H2b , H 3 , H 4 or protamine in solution at physiological conditions has been isolated from Drosophila melanogaster embryos . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Mononucleosomes prepared from Drosophila melanogaster nuclei contain the four core histones H2A , H2B , H 3 , and H 4 plus an additional histone like , acid soluble , chromosomal protein . ^^^ The amino acid composition of D 2 resembles the compositions of H2A and H2B . ^^^ However , peptide mapping reveals that D 2 is not a simple sequence variant of either H2A or H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It was found that histone H2B was the main acceptor , that H2A and H 1 were modified to a lesser extent , and that H 3 and H 4 were only slightly modified . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It is not inhibited by polyethyleneimine , spermine , or the other histones H2A , H2B , H 3 , or H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Differences were not observed on SDS gels in the electrophoretic mobilities of histones associated with either the nucleosome core particle ( histones ( H2A , H2B , H 3 , H 4 ) or the nucleosome linker region ( histone H 1 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Pancreatic histones were isolated by column chromatography and their degree of ADP ribosylation evaluated both by gel electrophoresis and by chromatography : histone H 1 was the main acceptor while the core histones H 3 , H2B , and H2A were lightly labelled . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Polyacrylamide electrophoresis on high resolution acid urea gels separated the five histone fractions in the sequence H 1 , H2A , H2B , H 3 , and H 4 . ^^^ Furthermore , Physarum histones H 1 , H2A , and H2B have higher molecular weights on sodium dodecyl sulfate ( SDS ) gels than the corresponding calf fractions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
These bound nucleosome cores are heavily enriched in transcribed DNA sequences , are deficient in histones H2A and H2B , and undergo a reversible change in structure on RNA polymerase 2 binding . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When purified macronuclei are incubated with [ 32P ] NAD+ , histones H 1 , H2A , H2B , and H 3 are ADP ribosylated . ^^^ Furthermore , histones H 1 , H2A , H2B , and H 3 contain fucose and mannose residues as evidenced by the incorporation of [ 3H ] fucose and by the specific binding to these proteins of gorse seed lectin and concanavalin A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The nucleosomal core histones H2A , H2B , and H 3 of the chicken can be resolved by polyacrylamide gel electrophoresis in the presence of nonionic detergents into two primary structure variants each , which occur in different relative amounts in various adult tissues . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Physarum microplasmodia have five major histone fractions , and we show by amino acid analysis , apparent molecular weight on three gel systems containing sodium dodecyl sulfate , mobility on gels containing Triton 10 100 , and other characterizations that these fractions are analogous to mammalian histones H 1 , H2A , H2B , H 3 , and H 4 . ^^^ The core histones from Physarum , histones H2A , H2B , H 3 , and H 4 , are rapidly acetylated ; histone H 4 shows five subfractions , analogous to the five subfractions of mammalian histone H 4 ( containing zero to four acetyllysine residues per molecule ) ; histone H 3 has a more complex pattern that we interpret as zero to four acetyllysine residues on each of two sequence variants of histone H 3 ; histones H2A and H2B show less heterogeneity . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Core histones ( H2A , H2B , H 3 , H 4 ) 2 , were reconstituted with the synthetic polynucleotides poly ( dA dT ) 10 poly ( dA dT ) and poly ( dG dC ) 10 poly ( dG dC ) to yield synthetic chromatins containing 200 basepairs per octamer . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Electrophoretic analysis demonstrated that like polyanions , summary histone forces out histone HI and partially histones H2B and H2A from chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
No acetate turnover was found in histones H2A and H2B compared with histones H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using an acellular system , with isolated chromatin as a template , and E . coli RNA polymerase it was shown that irradiation of rats with a lethal dose ( 7 . 76 Gy ) caused a progressing , in time , decrease in the inhibitory effect of H 1 , H2a , H2b , H 3 and H 4 histones ( particularly H2a histone ) on RNA synthesis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Gel electrophoretic analysis of the histone chemical acetylation in the nucleosome core particles with acetic andydride revealed availability of about 14 lysine residues of histone H2A , 15 21 of H2B , 8 11 H 3 and 6 9 H 4 . ^^^ Moderately lysine rich histones H2A and H2B were found to be more susceptible to acetylation than arginine rich H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chicken erythrocyte nucleosome core particles can be dissociated quantitatively into histones ( H 3 , H 4 ) 2 bound to 146 base pairs of DNA , and 2 ( H2A , H2B ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The HPLC histone fractions ( identified by their electrophoretic mobilities ) were eluted from the column in the following order : H 1 , H2B , ( LHP ) H2A , ( MHP ) H2A + H 4 , ( LHP ) H 3 , and ( MHP ) H 3 ( where LHP and MHP refer to the less hydrophobic and more hydrophobic histone variants ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A method for the complete and specific removal of histones H2A and H2B from nucleosome core particles is presented . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The molar proportions H 3 : H2B : ( H2A + protein A 24 ) : H 4 are 1 : 1 : 1 : 1 , viz . identical with those reported by others for somatic cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In absence of butyrate , we have detected four , three and two different levels of acetylation respectively for H 4 , H 3 , H2A and H2B . ^^^ H 3 and H 4 present a higher turnover of the acetate groups than H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Those regions most sensitive to the nuclease , amounting to some 10 % of the chromatin , consisted mainly of mononucleosomes with equimolar amounts of the inner histones H2A , H2B , H 3 , and H 4 , very little H 1 , and equimolar amounts of the two small high mobility group ( HMG ) proteins , HMG 14 and 17 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , somatic histone synthesis , with the possible exception of H2A and H2B , was not detectable at the pachytene stage . ^^^ In vivo treatment of rats with hydroxyurea reduced DNA synthesis in the testis to 1 % of control values and significantly reduced the synthesis of H 3 , H2B , H2A , and H 4 , with the greatest effect being on H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chromatin and a subunit of chromatin containing a complex of DNA and the core histones H2A , H2B , H 3 , and H 4 have been prepared from cultured Chinese hamster cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The estrogen receptor binds strongly to histones H2B and H2A , moderately to histones H 3 and H 4 , and poorly to histone H 1 . ^^^ In the presence of histones H2B or H2A , the position at which the estrogen receptor focuses in an isoelectric gradient is shifted to a more basic zone . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By the time the fertilized egg gives rise to a blastula or gastrula embryo , the chromatin has a considerably shorter repeat length and , in addition , a sequence of different histone variants of H 1 , H2A , and H2B has appeared . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Both particles contain 146 base pair lengths of DNA wrapped around an octamer of H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
H 1 mRNA and H 4 mRNA are relatively more enriched in the free RNPs than are the mRNAs for H2A , H2B , and H 3 . ^^^ These data suggest that histone mRNA , as a class , is more efficiently utilized as a template than the average mRNA and , of the cytoplasmic histone mRNAs , the mRNAs for histones H2A , H2B , and possibly H 3 are selected more frequently for translation than those for H 1 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Electrophoretic analysis of acid soluble chromosomal protein isolated from the erythrocytes of the bullfrog Rana catesbeiana reveals that the nucleated erythrocytes contain five major histones ( H1A , H2A , H2B , H 3 , and H 4 ) and three minor histone like proteins ( H1B , R 1 , and R 2 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
As effectors the following tumor cells transplanted in syngeneic mice were used : EL 4 ( H 2b ) , MX 2 ( H2b ) , L 1210 ( H2d ) , SA 1 ( H2a ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Amino acid composition , electrophoretic mobility and partial sequences identify one variant each of the histones H 3 and H 4 , whereas the histones H2A and H2B are represented by two variants each . ^^^ In the yeast histones H 3 and H 4 7 % of the residues , positioned in the partial sequences vary if compared with the corresponding histones from higher plants and animals , for the histones H2A and H2B from yeast this figure is 20 % . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The levels of H2A and H2B mRNAs as a function of cell cycle stage were determined by hybridization methods . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The copy number of yeast histone genes was increased by inserting an extra H2A , H2B gene pair into the haploid genome by the technique of yeast transformation . ^^^ The steady state levels of histone H2A , H2B mRNAs are not elevated in transformed strains , and they correspond to the levels measured for the parental strain . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
During the accumulation period , H2A and H2B enter chromatin immediately , while entry of H 3 and H 4 is more prolonged . ^^^ H2A and 70 % of H2B are salt stable and remain with newly synthesized polynucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The protease readily degraded H 1 , H 5 , and H 3 , moderately degraded H2b , and only slightly degraded H2a and H 4 in nucleosomes and nucleosome cores . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
During salt extraction of chromatin , the protease is released at an ionic strength between that required for the extraction of the slightly lysine rich histones ( H2A and H2B ) and the arginine rich histones ( H 3 and H 4 ) . ^^^ The reassociation of this nonhistone protein to DNA has an absolute requirement for the H 3 H 4 tetramer and is only enhanced by the H2A H2B dimer in the presence of the tetramer . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
On the basis of the reconstitution of a hybrid nucleosome containing calf histones H2A , H2B , and H 3 and yeast histone H 4 , it was concluded that variations in the yeast H 4 sequence are unlikely to be responsible for the apparent decrease in the stability of yeast nucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Few punctual changes are observed in the central region ( residues 18 118 ) , which interacts strongly with histone H2B to form the dimer H2A H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A , H2B , H 3 , and H 4 are acetylated to varying extents in the transcriptionally active macronucleus . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Pulse chase experiments with [ 3H ] lysine labeled tissue culture cells reveal that newly synthesized nucleosomal histones H2B , H 3 , H 4 ( and possibly H2A ) in chromatin are more accessible to histone acetylase in vivo than are older , pre existing histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The distribution of newly synthesized core histones H2A , H2B , H 3 and H 4 relative to the DNA strand synthesized in the same generation has been examined in replicating Chinese Hamster ovary cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The histones were first separated into a 0 . 5 M HClO 4 soluble fraction ( H 1 ) and an insoluble fraction ( H2A , H2B , H 3 , and H 4 ) . ^^^ The insoluble fraction was chromatographed on a large column of Bio Gel P 60 with 20 mM HCl containing 250 mM NaCL at 15 degrees C , yielding H2A + H 3 , H2B , and H 4 fractions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The amino acid analysis of purified histones fragments H2A , H2B and H 4 revealed that they are similar to the corresponding products of proteolysis of erythrocyte chromatin histones , whose primary structure has already been established . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
DNA fragment complexed with H2a and H2b and SN 7 particle containing six histones ( H2a , H2b , 2H3 and 2H4 ) and 108 b . p . ^^^ These results are interpreted in terms of a nucleosomal model in which H2a H2b pairs are localized in the peripheral parts of the nucleosomal DNA superhelix . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
UV differential study of the histones H2A H2B H 3 H4 octamer . ^^^ The individual calf thymus histones H2A , H2B , H 3 and H 4 , the dimer H2A H2B , the tetramer ( H 3 H4 ) 2 and the octamer ( H2A H2B H 3 H4 ) 2 were studied by differential UV absorption i . e . observing absorption shifts of tyrosyl residues due to thermal perturbations . ^^^ In addition these authors suggested that the interactions which maintain the four histones as an octamer involve the weak association of one ( H 3 H4 ) 2 tetramer with two H2A H2B dimers and might be due essentially to histidine lysine or histidine tyrosine hydrogen bonds . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Primary structure of the histone H2A and H2B genes and their flanking sequences in a minor histone gene cluster of Xenopus laevis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In isolated nuclei , this analog was found to inhibit acetylation of histones H2a and H2b very much more strongly than that of histones H 3 and H4 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Role of histone pairs H2A , H2B and H 3 , H 4 in the self assembly of nucleosome core particles . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Analysis of the acid soluble proteins of the core particles indicated that histones TH2B and X 2 are constituents of the core particles , in addition to the somatic histones H2A , H2B , H 3 and H 4 . ^^^ The acid soluble proteins of the oligonucleosomes comprised all the histones , including both the somatic ( H 1 , H2A , H2B , H 3 , H 4 and X 2 ) and the testis specific ones ( TH 1 and TH2B ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the presence of all five histones , the enzyme catalyzes the acetylation in the order of H 3 greater than H 4 greater than H2b greater than H2a greater than H 1 and appears to operate in a nonprocessive manner . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Variants of H2a and H2b histones from wheat embryos and pea shoots have been isolated and characterized by two dimensional gel electrophoresis , amino acid content , and peptide mapping . ^^^ In striking contrast to the animal H2a or H2b variants which co migrate on sodium dodecyl sulfate polyacrylamide gels , their plant counterparts have differential electrophoretic mobilities . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
H2A and H2B fractions recognize the G C base pairs , while H 3 and H 4 ( arginine rich fractions ) recognize the A T base pairs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Complexes of DNA with the H2A + H2B histone pair banded in metrizamide as one , light fraction at the density of 1 . 140 g / cm3 . ^^^ Among complexes of DNA with single histones H2A , H2B , H 3 and H 4 only the complex DNA H 4 formed a component having in metrizamide a density of 1 . 200 g / cm3 , similar to the density of purified chromatin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It is concluded that the animal H 4 sequences and their postsynthetic modifications have been strongly conserved during the evolutionary process leading to man , as strongly as or more strongly than the H 3 sequence , and much more strongly than the H2A and H2B sequences . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The late forms of H2A and H2B are first synthesized at around hatching , several hours after late Hl forms appear . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
No significant difference between the three types of core particles could be demonstrated by electron microscopy , circular dichroism , or immunochemical analysis with antisera to histone H2B , H2A , and H 3 . ^^^ Core particles were also reconstituted with calf thymus non acetylated H 3 , H2A , and H2B with either mono , di , or tri acetylated H 4 isolated from cuttle fish testes . ^^^ Binding to core particles of antibodies specific for H2A , H 3 , and for the IRGERA ( synthetic C terminal ) peptide of H 3 was considerably decreased when di or tri acetylated H 4 was used for reconstitution , whereas binding of H2B antibodies remained the same . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In accordance with the strength of their interaction with histone H 4 , the individual histone fractions can be arranged in the following order : H 4 greater than H2a greater than H2b greater than H 1 and protamine . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A common property of the promoters was their ability to increase the asymmetric environment of the aromatic side chains of `` inner histones ' ' H2B and H 4 and a H2A H 4 mixture . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone H2A and H2B fractions did not induce differentiation of M 1 cells at concentrations of 10 to 100 microgram / ml but did induce differentiation at a high concentration ( 200 microgram / ml ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Theoretical prediction of the end of the spatial packing of the polypeptide chains of histones H2A and H2B ] . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Their amino acid composition shows similarities to that of the H2A and H2B histone and has a molecular weight of 15 , 500 + / 300 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
After hypophysectomy the molar proportions of histones H 1 , H2B and ( H2A + protein A 24 ) in seminiferous epithelial cells of rat testis increased while their corresponding variants TH 1 10 , TH2B 10 and X 2 decreased , but the molar proportions of major class histones ( i . e . , sum of subfractions ) remained relatively constant and similar to the proportions in somatic cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the medium of physiological ionic strength the binding sequences of more and less competitive histone fraction molecules to DNA can be represented as follows : H3+H4 , H2a+ +H2b and H 3 , H 4 , H2a , H2b and H 1 , which is indicative of the absence of histone complexes in water and their presence in 0 . 15 M NaCl , in addition to individual molecules . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2a , H2b , H 3 and H 4 as well as protamines and protamine like proteins are represented in chromatin as a sequence of subfractions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Gel electrophoresis of the released proteins and of those bound to the residual chromatin showed that histone H 1 is dissociated more easily than the core histones ( H2A , H2B , H 3 and H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Within the histone / DNA ratio equal to 1 . 4 , H 3 , H 4 , H2A and H2B are bound to DNA without competition , i . e . at a ratio in which they are added to DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It has been demonstrated for the first time that with an elevation in the amount of supplementary total histone there took place a release of natural histones of chromatin , first of HI and then of H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast more than 50 % of newly synthesized H2A and H2B , and essentially all of new H 1 , are deposited at sites on the bulk chromatin distinct from that material containing newly replicated DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The core histone complex ( H 3 : H 4 : H2A : H2B ) 2 and products of dissociation , the H2A : H2B : dimer and the H 3 : H 4 tetramer , were isolated from chicken erythrocyte chromatin by several literature methods as well as gel filtration on Bio Gel A15m at various salt concentrations . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four histones H 3 , H 4 , H2A and H2B are found in equimolar amounts , as expected for the core histone octamer . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The catalytic subunit phosphorylates histones H 1 , H2a , H2b and protamine and to a far less degree histones H 3 , H 4 and casein ( H2b greater than H 1 greater than H2a greater than protamine much greater than H 3 greater than casein ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Three histone fractions of the complex ( H2a , H2b and H 4 ) contained nonhistone proteins which were not separated by gel chromatography . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Five histone molecular species , H 1 , H2A , H2B , H 3 , and H 4 , of calf thymus were subjected to gel electrophoresis and gel chromatography in the presence of a cationic surfactant , cetyltrimethylammonium bromide ( CTAB ) , and their behavior was compared with that in the presence of an anionic surfactant , sodium dodecyl sulfate ( SDS ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Under gel filtration on acrylex P 60 the total histone of the calf thymus is divided into 5 fractions [ H 1 ] , [ H2A ] , [ H2A , H3+ ( H 3 ) 2 , H2B ] , [ H2B ] and [ H 4 ] . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The mononucleosomes produced from salivary gland chromatin after the inhibition of endogenous proteinase activity exhibit an s 20 , w value of 11S and contain histones H 1 , H2A , H2B , H 3 and H4 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two dimensional polyacrylamide electrophoresis and radiolabeling in butyrate treated cultures indicate the presence of at least one site of internal acetylation in histone H2A , four sites of internal acetylation in histone H2B , five sites of internal acetylation in histone H 3 , and four sites of internal acetylation in histone H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The octameric nucleosomal core histone complex , ( H2A ) 2 ( H2B ) 2 ( H 3 ) 2 ( H 4 ) 2 , isolated from rat liver , undergoes dissociation during gel exclusion chromatography as a result of dilution occurring in the columns . ^^^ The elution pattern at pH 7 . 0 and 4 degree C showed a sharp leading peak containing all four histones but predominantly H 3 and H 4 , and a trailing peak containing equal amounts of histones H2A and H2B . ^^^ Its apparent molecular weight , histone composition and pattern of further dissociation in relation to column length suggest that this species is the hexamer , ( H2A H2B ) ( H 3 ) 2 ( H 4 ) 2 . ^^^ At pH 7 . 0 and 4 degrees C the dissociation of the core complex appears to be as follows : ( H2A ) 2 ( H2B ) 2 ( H 3 ) 2 ( H 4 ) 2 leads to ( H2A H2B ) + ( H2A H2B ) ( H 3 ) 2 ( H 4 ) 2 leads to 2 ( H2A H2B+ ( H 3 ) 2 ( H 4 ) 2 This dissociation was accelerated by an increase in temperature or decrease in pH and was accompanied by marked conformational changes as judged by circular dichroism measurements . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The binding orders of the first and the last molecules of histone type to DNA , studied at various DNA / histone ratios in the medium of physiological ionic strength , are the following : H3+H4 , H2A+H2B , H 1 and H3+H4 , H2A , H2B , H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The molar sum of these eight H2A species approximately equals the number of moles of H 4 , H2B , or H 3 in chromatin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The dissociation of histones H 1 , H2B and H2A from DNA was shown for the first time in the medium of physiological ionic strength ( 0 . 15M NaCl + 0 . 7 mM Na phosphate buffer , pH 7 . 0 ) by treating the whole histone DNA complex with high concentrations of whole histone from calf thymus chromatin . ^^^ The histones can be separated into three groups according to the strength of their binding to DNA : H 1 < H2B + H2A < H 3 + H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The other protein is a moderately lysine rich histone whose tryptic peptide map differs from that of both H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Image reconstruction to 22 A resolution of the histone octamer ( H 3 ) 2 ( H 4 ) 2 ( H2A ) 2 ( H2B ) 2 shows it to have a 2 fold axis of symmetry , and the overall shape of the left handed helical spool on which to wind about two turns of a flat superhelix of DNA in the nucleosome . ^^^ We propose that the ( H 3 ) 2 ( H 4 ) 2 tetramer forms a dislocated disk which defines the central turn of DNA , while the two H2A H2B dimers lie one on each face , each associated with about one half a turn . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It has been shown for the first time that heparin , one of the natural polyanions , is capable of dissociating the histones H 1 , H2A and H2B from chromatin in a medium of `` physiological ' ' ionic strength : 0 . 15 M NaCl + 0 . 7 mM Na phosphate buffer , pH 7 . 0 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Sea urchin sperm chromatin contains forms of H 1 , H2A , and H2B which differ from those present in adult tissues . ^^^ We have delineated some effects of the variant H2A and H2B on chromatin by study of the structure of the core particle from Strongylocentrotus purpuratus sperm . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The enhancement of ANS fluorescence produced by histones Hv ( a roughly equimolar mixture of histones H2A , H2B , H 3 and H 4 ) in 2 . 0 M NaCl , pH 7 . 5 , is higher than that produced by histone H 1 under identical conditions . ^^^ Both the H2A H2B and the H 3 H4 complexes cause a similar enhancement of the ANS fluorescence . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Acetylase A , a highly purified nuclear enzyme , catalyzed the acetylation of 1 ) nucleosomally bound histones in the order H 4 > H2a = H2b > H 3 , and 2 ) free histones in the order H 4 > H 3 > H2b > H2a . ^^^ In support of this view , we find that the acetylation of histones H 4 , H2a , and H2b in nuclei is inhibited by urea , salt , or N ethylmaleimide treatments to a very different extent than is the acetylation of histone H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The DNA sequences of the entire structural H 4 , H 3 , H2A and H2B genes and of their 5 ' flanking regions have been determined in the histone DNA clone h 19 of the sea urchin Psammechinus miliaris . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The acetylating enzyme transfers [ 3H ] acetyl groups from [ 3H ] acetyl coenzyme A to the endogenous histones H2A , H2B , H 3 and H 4 in nucleosomes as well as to free histones added to the reaction mixture . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Analyses of histone deposition during the inhibition of DNA replication established that acetylated chromatin is the preferential target for H2A / H2B exchange . ^^^ These experiments provide evidence for the highly selective assembly of newly synthesized H 3 , H2A , and H2B with acetylated H 4 , and for the involvement of histone acetylation in dynamic chromatin remodeling . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
RESULTS : In generalized morphea , IgG AHAs strongly reacted with histones H 1 , H2A , and H2B ; and IgM AHAs strongly reacted with H 1 and H2B , as determined by means of enzyme linked immunosorbent assay . ^^^ CONCLUSIONS : Our data suggest that AHAs in localized scleroderma are directed against native chromatin , since H 1 , H2A , and H2B occupy a relatively exposed portion of chromatin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Increased levels of IgA antibodies to all five major histones ( H 1 , H2A , H2B , H 3 , H 4 ) were found in all four disease groups when compared to normal controls . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast , we did not detect IgG antibodies specific for H2B , H2A H2B , DNA , H2A H2B DNA or nucleosome in lupus dogs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The frequency of occurrence of anti histone antibodies ( AHA ) regarding the type of histone fraction ( H 1 , H2A , H2B , H 3 and H 4 ) or the regions of histones was not significantly different in the three subsets of JCA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Low levels of IgG antibodies to histones H 1 , H2A , H2B , H 3 , and H 4 , to Hsp 70 and ubiquitin stress proteins , Ro / SSA and La / SSB proteins and myosin were detected in some of these sera . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Comparison of the sequences of actin and the protein components of nucleosome suggests that H2A may contain an adenosine binding site similar to the adenosine motif of actin , H 1 and / or H2B phosphate / Ca2+ binding sites corresponding to the phosphate 1 motif of actin , HMG 17 a phosphate / Ca2+ binding site corresponding to the phosphate 2 motif of actin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Evidence obtained from the covalent modification of such natural substrates as calmodulin , histones ( H2A , H2B ) and some cell membrane receptors with ubiquitin indicates that the reversible interconversion of proteins with ubiquitin followed by concomitant functional changes may be of prime importance . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This result , combined with the finding that overexpression of SIS 2 is extremely to a strain containing lower than normal levels of histones H2A and H2B , suggests that SIS 2 might function to stimulate transcription via an interaction with chromatin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Of the core proteins , H2A was more cross linked than H 4 , whereas the bands for H2B and H 3 melted into one in chromatin and H 1 depleted chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Thermodynamic studies of the core histones : ionic strength and pH dependence of H2A H2B dimer stability . ^^^ The thermal stability of the core histone dimer H2A H2B has been studied by high sensitivity differential scanning calorimetry and circular dichroism spectroscopy . ^^^ The unfolding transition temperature of the 28 kDa H2A H2B dimer increases as a function of both the ionic strength of the solvent and the total protein concentration . ^^^ The H2A H2B dimer is stable mainly between pH 5 . 5 and 10 . 5 . ^^^ Analysis of the data shows that at low ionic strength and pH values between 6 . 5 and 8 . 5 , the H2A H2B dimer behaves as a highly cooperative system , melting as a single unit without any detectable intermediates of dissociated , yet folded , H2A and H2B monomers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Immunoglobulin M productivity of a human human hybridoma line , HB4C5 , was enhanced by the addition of histones H 1 , H2A , and H2B in serum free medium , which are lysine rich histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Phosphate analogs such as AlF 4 efficiently counteract the labeling of H 1 , while they do not compete for labeling of histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The H2A and H2B genes of the Xenopus xlh 3 histone gene cluster are transcribed in opposite directions from initiation points located approximately 235 bp apart . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Variants csH2A , alpha H2A , beta H2A , gamma H2A , delta HA , H2AF . / Z , alpha H2B , beta H2B , and gamma H2B showed up to sevenfold differences in level of monoubiquitination between variants , and individual variants showed up to sixfold changes during development . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Binding was observed to all core histones ( H2A , H2B , H 3 and H 4 ) and , although weaker , to the linker histone H 1 as well . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Elevated gene dosage of either histones H 3 and H 4 or H2A and H2B results in a severe growth defect in combination with an hpr 1 null mutation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Proteolysis of rat liver chromatin by the Arg C peptidase , clostripain , is characterized by a progressive fragmentation of the N terminal segments of the four core histones H2A , H2B , H 3 and H 4 , until a well defined limit digest is reached . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
An increase in the activity of histone associated rat thymus nucleus proteinases specific for histones H2A , H2B and H 1 was shown after gamma irradiation or hydrocortisone treatment of animals . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Serial bleedings of 27 GVHD mice were screened with a panel of antigens including the five histones H 1 , H2A , H2B , H 3 and H 4 , 15 histone peptides , core particles , dsDNA , heat shock proteins hsp 70 and ubiquitin , a branched peptide of ubiquitinated H2A ( U H2A ) , poly ( ADP ribose ) and SSB / La protein . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
High mobility group proteins 14 and 17 can space nucleosomal particles deficient in histones H2A and H2B creating a template that is transcriptionally active . ^^^ To begin to investigate how these proteins may prevent the close packing of nucleosomes , assembly reactions were carried out in which the relative amounts of HMGs 14 and 17 , histones H2A and H2B , and the N1 / N2 . ( H 3 , H 4 ) complex were varied in assembly reactions . ^^^ Under conditions in which histones H2A and H2B were limiting and in the absence of HMGs 14 and 17 , micrococcal nuclease digestion of the assembled product produced a ladder of DNA fragments that was much less well defined and which included DNA that was associated with subnucleosomal structures . ^^^ Analysis of the protein composition of chromatin formed in the presence or absence of HMGs 14 and 17 reveals that HMGs 14 and 17 might be able to substitute for a histone H2A H2B dimer in a H2A / H2B deficient nucleosome . ^^^ Finally , although the mechanism of action is not known , HMGs 14 and 17 can partially overcome inhibition of initiation of transcription caused by the formation of nucleosomal particles deficient in histones H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have isolated and molecularly identified several of these proteins : histones H2A , H2B , H 3 and H 4 . ^^^ The assessment 4 days later revealed deficient USE patterns , particularly diminished and missing bands of the H2A , H2B , and H 3 histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Prior injection of 200 micrograms of core histones ( H2A , H2B , H 3 , H 4 ) resulted in high glomerular binding of the IC ; 18 . 1 % of the injected dose ( measured as 125I DNA ) was bound at 15 minutes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have developed a procedure to purify nucleosomal assembly competent histones as a mixture of H2A , H2B , H 3 and H 4 from isolated nuclei of the yeast Saccharomyces cerevisiae with a purity of 70 80 % . ^^^ The length of DNA fragment wrapping around a core histone particle and the molar ratio of histone components in an assembled nucleosome particle were estimated to be 150 + / 10 bp long and H2A : H2B : H 3 : H 4 = 1 . 0 : 0 . 9 : 0 : 9 : 1 . 0 , respectively . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone H2B ( and H2A ) ubiquitination allows normal histone octamer and core particle reconstitution . 146 bp core particles were assembled from reconstituted hybrid histone octamers where either histone H2A or H2B were replaced by their ubiquitinated counterparts uH2A and uH2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The rapid transfer and selective association of histones H2A and H2B onto negatively coiled DNA at physiological ionic strength . ^^^ The interaction of histones H2A and H2B with closed circular DNA maintained in either a positive or negatively coiled state has been studied . ^^^ Histones H2A and H2B have a 10 fold preference for DNA that contains performed negative coils as compared to DNA that is positively coiled or topologically unrestrained . ^^^ It was also observed that histones H2A and H2B , when initially reconstituted onto positively coiled DNA , transfer very efficiently to negatively coiled DNA at 100 mM NaCl . ^^^ By utilizing a cross linking agent ( disuccinimidyl suberate ) , it was found that histones H2A and H2B could be cross linked into a tetrameric structure when on negatively coiled DNA but not on positively coiled DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Sperm nuclear basic proteins of Bufo japonicus consist of 2 distinct protamines , whereas those of Xenopus laevis consist of 6 sperm specific basic proteins ( SP 1 6 ) in addition to H 3 , H 4 and smaller amounts of H2A and H2B . ^^^ Despite differences in their initial compositions of chromatin , sperm nuclei exposed to amphibian egg extracts rapidly decondense , lose sperm specific basic proteins , and concomitantly form an ordinary nucleosome core consisting of H2A , H2B , H 3 , H 4 , and cleavage stage specific subtype H1X . ^^^ In this remodeling process , nucleoplasmin plays dual roles as a molecular chaperone , selectively removing sperm specific basic proteins from , and bringing H2A and H2B to , sperm DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Antibodies to histone ( H2A H2B ) DNA complexes in the absence of antibodies to double stranded DNA or to ( H2A H2B ) complexes are more sensitive and specific for scleroderma related disorders than for lupus . ^^^ To assess the role of antibodies to histones H2A , H2B , and anti double stranded DNA which form ( H2A H2B ) DNA complexes in patients with scleroderma related disorders . ^^^ Antibodies to histone ( H2A H2B ) DNA complex were more commonly seen in patients with scleroderma related disorders than in those with SLE ( P < 0 . 0001 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In vivo nucleoplasmin binds histones H2A and H2B and transfers them to DNA . ^^^ It binds and removes sperm basic proteins and replaces them by histones H2A and H2B , again forming nucleosomes , and resulting in decondensation of the compacted sperm chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The fact that the shape and size of the original structure were incorrect is surprising and unusual , since the electron density map that produced the original model was clear for most parts of the structure ; one could easily see the well formed right handed helices of the H2A and H2B molecules , and the ordered parts of the H2A and H2B molecules could be easily traced from end to end . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
During induced regeneration age related changes in liver manifested themselves in decreasing the cellularity per gram wet weight , in slowing down the increase in DNA and histone contents per organ , in changing the mutual proportions of histone fractions H 1 , H2A + H2B , H 4 and in increasing the H 1 zero variant within histone H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Two of these loci , HTA 1 HTB1 and HTA 2 HTB2 , each encode histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Natural nuclear DNA binding proteins , the histones ( H 1 , H2a , H2b , H 3 , and H 4 ) , were modified and used as receptor targeted DNA carriers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B are required for association of histone H 5 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The biological significance of glycyrrhizin and glycyrrhetinic acid derivative induced selective phosphorylation of histones H2A and H2B by A kinase in vitro . ^^^ Histones H2A and H2B were found to be glycyrrhizin ( GL ) binding proteins , because ( 1 ) the two histones H2A H2B pairs were isolated selectively from the crude histone preparations of calf thymus by means of GL affinity column chromatography ( HPLC ) ; ( 2 ) phosphorylation of these two histones by A kinase was remarkably stimulated by native GL or oGA ( a derivative of glycyrrhetinic acid ) at 20 microM ; and ( 3 ) in the crude histone preparations of calf thymus , these two histones were selectively phosphorylated by A kinase in the presence of both dsDNA and 20 microM oGA or 20 microM GL . ^^^ The provided data suggest that the GL induced selective phosphorylation of histones H2A and H2B by A kinase may be implicated in the transcriptional activation involved in the biological activities of the drug . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the corresponding splenic material , fragments of histones H2A and H2B constituted most of the low molecular mass proteins , and no protein AA was detected . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The sequence from the left arm includes genes for histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Phylogenetic analysis of the core histones H2A , H2B , H 3 , and H 4 . ^^^ We have constructed phylogenetic trees for the core histones H2A , H2B , H 3 , and H 4 . ^^^ Histones which form dimers ( H2A / H2B and H3 / H4 ) have very similar trees and appear to have co evolved , with the exception of the divergent sea urchin testis H2Bs , for which no corresponding divergent H2As have been identified . ^^^ The trees for H2A and H2B also support the theory that animals and fungi have a common ancestor . ^^^ H 3 and H 4 are 10 fold less divergent than H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Besides the previously reported low H2A . 1 / H2A . 2 ratio [ Blankstein and Levy : Nature 260 : 638 640 , 1976 ] , chromatin from the most tumorigenic cell type showed the lowest H2B . 2 to H2B . 1 ratio , highest levels of histone H 4 acetylation , and the most pronounced change in relative amounts of two major electrophoretic bands of histone H 1 variants as compared to the less malignant cell types . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The activity of CK 2 holoenzyme , either native or reconstituted , toward calmodulin can be elicited by a variety of polybasic effectors , including polylysine , polyarginine , salmine , and histones H 4 , H 3 , and , to a lesser extent , H2a and H2b . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Dynamics of the interactions of histones H2A , H2B and H 3 , H 4 with torsionally stressed DNA . ^^^ The interactions of histones H2A , H2B and H 3 , H 4 with closed circular DNA maintained in either a positively or negatively coiled state have been studied . ^^^ Histones H 3 , H 4 were found to differ substantially from histones H2A , H2B with regard to the DNA topology with which they prefer to interact . ^^^ The results are consistent with a model in which transcription induced positive stress in advance of the RNA polymerase unfolds the nucleosome to facilitate the release of H2A , H2B . ^^^ The data are also consistent with a model in which histones H 3 , H 4 remain associated with the DNA during polymerase passage and serve as a nucleation site for the reassociation of H2A , H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four core histones H2A , H2B , H 3 , and H 4 were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis , which yielded each histone free of contamination by the others . ^^^ Further purification of histones H2A , H2B , and H 4 by reversed phase HPLC also yielded a tetrahydrotetrol of benzo [ a ] pyrene , indicating that these three histones had some labile adducts . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The expression of genes encoding five histones ( H 1 , H2A , H2B , H 3 and H 4 ) and the putative transcription factors HBP 1a ( 17 ) and HBP 1b ( c 38 ) was examined during early germination and in various tissues of young wheat seedlings . ^^^ The steady state levels of core histone ( H2A , H2B , H 3 and H 4 ) mRNAs were coordinately cell cycle dependent and paralleled the rate of DNA synthesis during early germination , whereas the expression pattern of the linker histone ( H 1 ) genes differed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 1 , H2A , H2B , H 3 , HIIA , HIIS , protamine , and the related preparations homeostatic thymus hormone and peptide MB 35 generated a dose dependent signal in both the human corticotropin releasing hormone ( CRH ) and the human adrenocorticotropic hormone ( ACTH ) IRMA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The DCA was sensitive to HCl and proteolytic enzymes and the anti DCA binding inhibited by histones H2A and H2B . ^^^ Differences of anti H2A and anti H2B were observed between anti DCA antibody positive and anti DCA antibody negative sera , and antibodies specific for the 1 15 region of H2A , the 1 25 region of H2B and the 1 29 region of H 4 were more frequent in the former sera than in the latter . ^^^ Our findings suggest that the anti DCA antibody is directed to a protein complex containing H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone H2B is more variable than H2A and the histone H 1 is the less conserved histone . ^^^ Some interesting observations concerning the non conserved regions of H2A and H2B in their extended C and N terminal regions are reported . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
H2a and H2b are isoforms that differ only by a pentapeptide insertion in the exoplasmic juxtamembrane region of H2a . 100 % of H2a is degraded in the ER , but up to 30 % of H2b folds properly and matures to the cell surface . ^^^ The sites of cleavage to form the 35 kD fragment are slightly different in H2a and H2b . ^^^ Two mutant H2b proteins , with either a glycine or proline substitution at the position of insertion of the pentapeptide in H2a , have metabolic fates similar to that of H2a . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Association of a human H 1 histone gene with an H2A pseudogene and genes encoding H2B . 1 and H3 . 1 histones . ^^^ These three overlapping segments of the human genome comprise genes coding for H3 . 1 , an H2A pseudogene , and an H2B . 1 gene downstream of the previously characterized H1 . 2 gene . ^^^ The same arrangement of an H 3 gene , an H2A pseudogene and an H2B gene downstream of an H 1 gene has been described within a mouse histone gene cluster [ Yang et al . : J Biol Chem 262 : 17118 17125 , 1987 ; Gruber et al . : Gene 95 : 303 304 , 1990 ] . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Conservation of the dimeric unit of H2A and H2B histones during the replication cycle . ^^^ The behavior of H2A and H2B histones during the replication cycle has been investigated . ^^^ H2A H2B dimer fractions obtained from MH 134SC cells labeled with suitable precursors were fractionated by rate zonal centrifugation in sucrose gradients containing 2 M NaCl . ^^^ Biological significance of the dimeric behavior of H2A and H2B is discussed in favor of the partially conservative model of histone octamer assembly . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Demethylation of somatic and testis specific histone H2A and H2B genes in F 9 embryonal carcinoma cells . ^^^ Transfection of in vitro methylated TH2B , somatic H2B , and mouse metallothionein 1 constructs into F 9 embryonal carcinoma cells revealed that the CpG islands of the TH2A and TH2B genes were demethylated like those of the somatic H2A and H2B genes and the metallothionein 1 gene . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
LG 2 1 reacts with a peptide from histone H 3 ( residues 30 45 ) , LG 2 2 recognizes the amino terminus of H2B ( residues 1 13 ) and BWA 3 binds an epitope corresponding to a region of high sequence similarity between H2A and H 4 ( residues 1 20 and 1 29 , respectively ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Propane sultone ( 0 . 1 mM ) induced a broadening of the H2A and H2B bands after a 24 h exposure and carbon tetrachloride ( 1 mM ) induced the formation of new histone forms in the H 1 fraction after 24 h and in the H 3 fraction after 3 h . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Further , newly synthesized histones H2A and H2B exchange preferentially with the nucleosomal histones H2A and H2B of this salt soluble chromatin fraction . ^^^ Analysis of the histones eluting from the hydroxyapatite bound chromatin demonstrated that hyperacetylated and ubiquitinated ( u ) , including multi ubiquitinated , H2A H2B . 1 dimers dissociated at lower concentrations of NaCl than unmodified dimers or dimers with histone variants H2A . ^^^ Our results support the idea that acetylation and ubiquitination of histones H2A and H2B . 1 increase the lability of H2A H2B . 1 dimers in transcriptionally active nucleosomes . ^^^ Z and H2B . 2 . stabilize the association of the H2A H2B dimer in nucleosomes . ^^^ The elevated lability of the H2A H2B dimer may facilitate processes such as the exchange of these dimers with newly synthesized histones , the elongation process of transcription and transcription factor binding . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
To characterize their immunoreactivity , competition radioimmunoassays were performed using purified histone fractions H 1 , H2a , H2b and H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The H2B and H 3 mRNAs are transcribed from one DNA strand , while the H2A and H 4 histone mRNAs are transcribed from the other . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Upon GAL 4 AH binding , nucleoplasmin specifically removed histones H2A and H2B from the nucleosome which enhanced the subsequent loss of the H3 / H4 tetramers onto competing DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
According to our model , the rapid deacetylation of distinct lysines in especially H2A and H2B would facilitate the association of anionic protein domains of regulatory proteins to specific nucleosomes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Ethanol did not change the amounts of outer histone H 1 or amounts of core histones ( H2A , H2B , H3 . 1 , and H 4 ) but increased the histone variants H3 . 2 and H3 . 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The highest salt concentrations used here are close to those required to dissociate core histone H2A and H2B from nucleosomal DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The known core histone genes , four H2A , seven H2B , and seven H 3 genes , respectively , encode two , three and three different protein variants , whereas the four known H 4 genes encode the same amino acid sequence . 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Relative to myelin basic protein , the enzyme exhibited about 8 , 62 , 130 , 33 , 5 , and < 0 . 1 % activity with histones H 1 , H2A , H2B , H 3 , and H 4 and with glycogen synthase alpha , respectively . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The other core ( H2A , H2B , and H 3 ) and H 1 histone mRNA transcripts exhibited similar sensitivity to pressure treatment . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The reduction in core histone acetylation was found in histones H 3 and H 4 , but not in H2A and H2B . 45 days after the withdrawal of the drug treatment , the inhibitory effect on core histone acetylation was recovered . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Presence of particular transcription regulatory elements in the 5 ' intergenic region shared by the chicken H2A 3 and H2B 5 pair . ^^^ The two chicken histone gene families , H2A and H2B , contain nine and eight members , respectively , within two major histone gene clusters . ^^^ Six genes each from families H2A and H2B have been found to be closely associated in inverted directions as H2A / H2B gene pairs . ^^^ Two previously sequenced H2A members ( H2A 1 and H2A 2 ) encode the same amino acid ( aa ) sequence ( class 1 ) , whereas seven sequenced H2B genes encode three different variants ( classes 1 , 2 and 3 ) . ^^^ In this study , we first sequenced H2A 3 , a member of the H2A family , which is located in inverted orientation and 350 bp upstream from H2B 5 , encoding the class 3 H2B protein . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chemical cross linking studies employing reversible photoactivatable cross linkers , combined with one and two dimensional electrophoretic analyses , indicate that in vitro HMG 1 binds to cores in close proximity to histones H2A and H2B and H 3 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The same mutations also eliminate autogenous regulation of the HTA 1 HTB1 locus by histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using RNA blot and run on transcription assays , it was shown that one arbitrarily selected subclass of each of the histone H2A , H2B , H 3 and H 4 gene families and of the genes encoding a p34cdc2 protein kinase and a mitotic cyclin were transcriptionally repressed in UV irradiated as well as fungal elicitor treated parsley cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal ( or core ) histone H2A , H2B , H 3 and H 4 genes and at least one histone H 1 gene . ^^^ The core histone genes are organized in clusters of H2A H2B and H 3 H4 pairs , in which each gene pair shows outwardly divergent transcription from a short ( < 300 bp ) intercistronic region . ^^^ One single H 1 gene was found in close linkage to a H2A H2B pair . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By searching the current protein sequence databases using sequences from human and chicken histones H1 / H5 , H2A , H2B , H 3 and H 4 , a database of aligned histone protein sequences with statistically significant sequence similarity to the search sequence was constructed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The core histone classes H2A , H2B , H 3 , and H 4 are the main group of proteins responsible for the folding of DNA in nucleosomes . ^^^ The core histone variant composition changes during postnatal development in rat cerebral cortex neurons ; H2A . 1 , H2B . 1 , H3 . 1 and H3 . 2 decay exponentially , whereas H2A . 2 , H2A . x , H2B . 2 , and H3 . 3 accumulate . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Unfolded structure and reactivity of nucleosome core DNA histone H2A , H2B complexes in solution as studied by synchrotron radiation 10 ray scattering . ^^^ Biol . 204 , 141 154 ] that histones H2A , H2B in the absence of H 3 , H 4 can associate with nucleosome core DNA ( 146 base pairs ) . ^^^ Here we describe a synchrotron 10 ray scattering study of core DNA ( H2A , H2B ) complexes in solution . ^^^ Our results obtained using different histone to DNA weight ratios and ionic conditions ranging from very low ionic strength to 0 . 2 M NaCl show that histones H2A , H2B are unable to fold core DNA . ^^^ Model calculations indicate that histones H2A , H2B produce very elongated structures even when the reconstituted complexes are prepared at physiological ionic strength . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This repeat contains genes for all five histone proteins ( H 1 , H2a , H2b , H 3 , and H 4 ) and differs from the previously reported one by a second EcoRI site . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Interestingly , these sequences in CBF A and CBF C were also homologous to the sequences in the histone fold motifs of histones H2B and H2A , respectively , and to the archaebacterial histone like protein HMf 2 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Sperm specific histone variants Sp H 1 and Sp H2B are maintained as phosphorylated derivatives N and O / P throughout spermatogenesis and early embryogenesis and egg specific histone variants CS H 1 and CS H2A are phosphorylated during early embryogenesis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Both euchromatin and heterochromatin contain nucleosomal particles ( composed of two molecules each of H2A , H2B , H 3 and H 4 ) , however histones have been shown to regulate genes in these regions in quite different ways . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The H2a alternatively spliced variant of the human asialoglycoprotein receptor H 2 subunit differs from the H2b variant by an extra pentapeptide , EGHRG , present in the ectodomain next to the membrane span . ^^^ H2a does not form a membrane receptor complex with H 1 as H2b does . ^^^ Therefore , the juxtamembrane sequence regulates the function of the transmembrane domain of a type 2 membrane protein as either a signal anchor sequence ( H2b ) or as a cleaved signal sequence , which generates a secreted product ( H2a ) . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here , we describe the mapping of new N terminal domains , in all four core histones ( H2A , H2B , H 3 and H 4 ) , required for the repression of basal , uninduced transcription . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However in repeated experiments when the histone RNA complex was injected into young MRL lpr / lpr animals at two weekly intervals , a significantly increased antibody response was detected against H 1 , peptide T 4 and some histone peptide residues ( 204 218 of H 1 , 1 20 and 65 85 of H2A , 1 25 of H2B , 1 21 of H 3 and 1 29 of H 4 ) compared to the control groups . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The sequences and levels of expression of the H 3 and H2b gene as well as the sequence of the H2a pseudogene have been determined . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Incubation of ADP ribose with histones H 1 , H2A , H2B , and H 4 at pH 7 . 5 resulted in the formation of ketoamine glycation conjugates . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The two state mechanism accounting for the unfolding of the H 3 H4 dimer at pH 4 . 5 is the same as that described for the H2A H2B dimer at neutrality . ^^^ Just like for the H2A and H2B histones , the H 3 and H 4 polypeptides are properly folded only when assembled as H 3 H4 dimers or in higher order histone assemblies . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Functional analysis of histones H2A and H2B in transcriptional repression in Saccharomyces cerevisiae . ^^^ The presence of H2A H2B dimers in nucleosomes can inhibit the binding of transcription factors to chromatin templates . ^^^ To study the roles of histones H2A and H2B in transcriptional repression in vivo , mutant forms of these histones were analyzed in two different assay systems . ^^^ One domain includes residues that fall in the beginning of the H2A H2B dimerization region , and the second is in the H2A N terminus , a region of potential interactions with nonhistone proteins . ^^^ The function of H2A and H2B in one repression assay was found to be dependent on three SPT ( suppressor of Ty ) genes whose products are important for chromatin mediated repression . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By coimmunoprecipitation analysis , dNAP 1 was found to be associated with histones H2A and H2B in a crude whole embryo extract , which suggests that dNAP 1 is bound to the histones in vivo . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
There are three histone H 3 genes , two of which are identical ; four histone H2a genes , two of which are identical , one histone H 4 gene ; and two histone H2b genes . ^^^ These histone H 3 and H2a genes encode approximately 40 % of the total H 3 and H2a mRNA , whereas the histone H 4 and histone H2b genes encode < 10 % of the total H 4 and H2b mRNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It has been shown that the administration of total histones ( H 1 , H 3 , H2B , H2A , H 4 ) , the total histones without histones H 4 ( H 1 , H 3 , H2B , H2A ) , H 1 histones at concentrations of 0 . 001 and 1 microgram per 100 g of body weight ( low and high concentrations ) to intact rats during 6 days leads to the decrease of T 4 amount in the blood plasm . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Transcription of the genes for the human histone proteins H 4 , H 3 , H2A , H2B , and H 1 is activated at the G1 / S phase transition of the cell cycle . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Out of the 18 glutamines of the four histones , nine ( namely glutamine 95 of H2B ; glutamines 5 , 19 , and 125 of H 3 ; glutamines 27 and 93 of H 4 ; and glutamines 24 , 104 , and 112 of H2A ) are the amine acceptors in free histones . ^^^ The structures of H2A and H2B do not appreciably change upon modification with DNC as determined by circular dichroism , and core particles reconstituted from these DNC modified histones are indistinguishable from native nucleosome cores . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Hybridization analysis of the entire 20 kb phage insert with probes for H 1 , H2A , H2B and H 3 histones was negative except for H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The domain of CBF C which interacts with CBF A included a large portion of this segment , one that corresponds to the segment of the histone fold motif in H2A used for interaction with H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Thirty nine histone genes , six H 1 , nine H2A , eight H2B , eight H 3 and eight H 4 , were located within a histone gene cluster of 110 kb , which was covered by five cosmid clones and two lambda clones . ^^^ Results of our sequence analyses , together with those reported previously , generated a set of the core histone amino acid sequences as follows : three H2A variants , four H2B variants , two H 3 variants and an H 4 protein . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The transcriptional effect could be reversed by the overproduction of histones H2A and H2B in an spt 4 mutant and histones H 3 and H 4 in all three spt mutants . ^^^ Suppression of the spt 4 transcriptional defect was dependent on the overproduction of both histones H2A and H2B , and required the presence of N terminal amino acids in both histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A delta hta 1 htb1 mutant with decreased levels of H2A and H2B histone proteins showed a pattern of Ty 1 and Ty 2 insertions at CAN 1 that was significantly different from that of both the wild type and a delta hta 2 htb2 mutant , which does not have altered histone protein levels . ^^^ Altered levels of H2A and H2B proteins disrupted a dramatic orientation bias in the CAN 1 promoter region . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast , the chemical induced stress involves growth arrest accompanied by a decrease in histone mRNA , particularly core histone H2B and H2A mRNA , and the induction of gadd 153 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have analysed the regulation of histone H2A , H2B , H 4 and beta tubulin RNA levels during the cell cycle of asynchronous cultures of Trypanosoma brucei by fluorescence in situ hybridisation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The gel produced by the addition of dextran sulfate ( DS ) to mouse lymphocyte nuclei was composed of histones ( H 1 , H2A , H2B , H 3 , and H 4 ) , DS , and DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Through sedimentation and immunoprecipitation analyses of HeLa cytosolic extracts , two somatic non nucleosomal histone complexes were detected : one containing nascent H 3 and H 4 , and a second containing H2A ( and probably H2B ) in association with the nonhistone protein NAP 1 . ^^^ Based on our findings a model is presented for the involvement of histone acetylation and NAP 1 in H2A / H2B deposition and exchange , during nucleosome assembly and chromatin remodeling in vivo . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A , H2B , H 3 and H 4 were reconstituted onto DNA to form nucleosomes and the polyamines were added either before or after histone addition . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Condensation of DNA into chromatin by the core ( H2A , H2B , H 3 , H 4 ) and linker ( H 1 , H 5 ) histones effectively represses transcription initiation from the promoters of genes that have been packaged . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
With the help of partial peptide sequence information , we have isolated and identified CS H 1 , H2A , H2B , H 3 , and H 4 cDNAs from egg poly ( A ) + mRNA of the sea urchin Psammechinus miliaris . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The 42 sequenced genes encode six H 1 variants , three H2A variants , four H2B variants , two H 3 variants , and one histone H 4 . ^^^ Analyses with antisense RNA probes common or specific for gene families H 1 , H2A , H2B , H 3 and H 4 indicated that the remaining members of each of the gene families were expressed more in the mutants than in DT 40 cells , resulting in maintenance of constant steady state levels of mRNAs . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This group of basic proteins is extremely conserved throughout evolution and includes five classes termed H 1 , H2A , H2B , H 3 and H 4 . ^^^ Similarly , core histone subtypes replacing the major forms of H2A , H2B or H 3 have been described . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The cleavage stage ( CS ) H 1 , H2A , and H2B histones of the sea urchin , which have previously been identified by their distinct electrophoretic mobility on Triton / acid / urea gels , are known to be maternally expressed during oogenesis and have been implicated in chromatin remodeling of the male pronucleus following fertilization . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Progression into the first meiotic division is sensitive to histone H2A H2B dimer concentration in Saccharomyces cerevisiae . ^^^ The yeast Saccharomyces cerevisiae contains two genes for histone H2A and two for histone H2B located in two divergently transcribed gene pairs : HTA 1 HTB1 and HTA 2 HTB2 . ^^^ This sporulation phenotype results from a partial depletion of H2A H2B dimers . ^^^ Since the expression patterns of HTA 1 HTB1 and HTA 2 HTB2 are similar in mitosis and meiosis , the sporulation pathway is therefore more sensitive than the mitotic cycle to depletion of H2A H2B dimers . ^^^ We hypothesize that the deposition of H2A H2B dimers in the mutant is unable to keep pace with the replication fork , thereby leading to a disruption in chromosome structure that interferes with the meiotic divisions . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The nucleosome contains of 200 base pairs of DNA complexed with four core histone complex : H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The ability of this protein to catalyze the conjugation of ubiquitin to histone H2A and H2B was also examined . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
N terminal sequence analysis of the 16 and 18 kDa proteins and of a tryptic fragment of the protein mixture revealed strong homologies with deduced cDNA or protein sequences of histones H2A , H2B , and H 3 of P . falciparum and other species . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
However , while histones H 3 and H 4 continued to be synthesized in early 1 cell embryos , synthesis of histones H2A , H2B and H 1 ( proteins required for chromatin condensation ) was delayed until the late 1 cell stage , reaching their maximum rate in early 2 cell embryos . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Biol . 11 : 5718 5726 , 1991 ) , with a spectrum of phenotypes similar to those caused by mutations in the genes encoding histone proteins H2A and H2B ( Malone et al . , Mol . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The main protein component was protamine 1 , but a complete histone complement ( H 1 , H2A , H2B , H 3 , and H 4 ) was also detected . ^^^ Immunocytochemistry showed localisation of H 4 , H2B , and H2A histones to the periphery of the nuclei , a region that corresponded to the C 2 chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The increased proteolysis of lysine rich histones ( H 1 , H2A , H2B ) was shown in swimming rats previously stimulated by prodigiosan . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
When M 1 was mixed with lysates of uninfected cells there was selective binding of histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The conjugation of ubiquitin to histones H2A and H2B has been established in higher eukaryotes and has been related to changes in chromatin organization . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The purified recombinant effectively acetylates H2A , H 3 , and H 4 but not H2B of core histone mixtures . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The chlamydial EUO GST gene product also cleaves very lysine rich calf thymus histone H 1 and chicken erythrocyte histone H 5 but displays no measurable activity towards core histones H2A , H2B , H 3 , and H 4 or chlamydial RNA polymerase alpha subunit . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
UBF could be stripped from ternary complexes with competitor DNA to liberate nucleosome cores , rather than free DNA , suggesting that UBF binding to nucleosome cores does not displace the core histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four core histone proteins , H2A , H2B , H 3 , and H 4 of Xenopus laevis have been individually expressed in milligram quantities in Escherichia coli . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The human asialoglycoprotein receptor H2a subunit contains a charged pentapeptide , EGHRG , in its ectodomain that is the only sequence absent from the H2b alternatively spliced variant . ^^^ H2b exits the endoplasmic reticulum ( ER ) even when singly expressed , whereas H2a gives rise to a cleaved soluble secreted ectodomain fragment ; uncleaved membrane bound H2a molecules are completely retained and degraded in the ER . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast , the N tails of both dimeric histones H2A and H2B are found essentially in a random coil conformation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have developed an assay involving a series of monoclonal and polyclonal antibody probes specifically reacting with a complete set of 40 overlapping synthetic peptides ( 6 to 28 residues long ) covering the whole sequence of the four core histones H2A , H2B , H 3 and H 4 . ^^^ At least 11 surface oriented linear regions were characterized on the mononucleosome ; namely , the N terminal domains of H2A ( residues 1 to 20 ) , H2B ( residues 1 to 25 ) and H 3 ( residues 1 to 30 ) , the C terminal domains of H2A ( residues 116 to 129 ) and H 4 ( residues 85 to 102 ) , and six domains located in internal segments in the primary structures of core histones ( 33 to 49 H2A , 65 to 85 H2A , 60 to 78 H2B , 50 to 70 H 3 , 111 to 130 H 3 and 42 to 59 H 4 ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Topoisomerase 1 mediated relaxation of minichromosomes assembled with either mutant histone H 3 or wild type H 3 together with histones H2A , H2B , and H 4 indicates that DNA is constrained into nucleosomal structures containing either mutant or wild type proteins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone octamers consisting of H2A , H2B , H 3 , and H 4 are reconstituted onto DNA duplexes containing an artificial nucleosome positioning sequence consisting of a tandem array of an alternating AT GC sequence motif . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B were not detectable in UAF . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Moreover , analyses involving a RNase protection assay , SDS PAGE or Triton acid urea PAGE revealed not only that in the 1 / 2 delta 110 kb mutant the steady state levels of total mRNAs of gene families H 1 , H2A , H2B , H 3 and H 4 remained constant , but also that the amounts of histones H 1 , H2A , H2B , H 3 and H 4 were not changed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The proteasome inhibitors , lactacystin and N acetyl leucyl leucyl norlucinal , caused a rapid and near complete loss of approximately 22 23 kDa ubiquitinated nucleoproteins , which we have identified as monoubiquitinated nucleosomal histones H2A and H2B by immunological and two dimensional electrophoretic techniques . ^^^ DNA replication and RNA transcription were decreased by the proteasome inhibitors most strongly after 90 % of the ubiquitin had been removed from ubiquitinated histones H2A and H2B , suggesting a relationship between the nucleosomal histone ubiquitin status and the processing of genetic information . ^^^ These results suggest that deubiquitination of nucleosomal histones H2A and H2B may play a previously unrecognized role in the cellular stress response , as well as in the processing of chromatin , and emphasize the important role of the proteasome in cellular homeostasis . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the established contig of the histone gene containing cosmids , 16 histone genes and 2 pseudogenes were identified : one H 1 gene ( H1 . 5 ) , five H2A genes , four H2B genes and one pseudogene of H2B , three H 3 genes , and three H 4 genes plus one H 4 pseudogene . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The accompanying proteins were tentatively identified as histones H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Gonadotrophin releasing activity of histones H2A and H2B . ^^^ We report that histones H2A and H2B possess gonadotrophin releasing activity in vitro and assess the signal transduction pathways involved in these effects . ^^^ Perifusion of cells with histone H2A ( 30 muM ) or histone H2B ( 30 muM ) , markedly stimulated LH release but failed to elicit any FSH response . ^^^ Incubation of pituitary cells with gonadotrophin releasing hormone ( GnRH ) and histones H2A or H2B showed a stimulatory effect on LH and FSH release which was similar to the sum of the separate effects . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Thyrotropin releasing activity of histone H2A , H2B and peptide MB 35 . ^^^ We studied the specificity and signal transduction pathways involved in the thyrotrophin ( TSH ) releasing activity of histones H2A , H2B and peptide MB 35 , a H2A fragment , using perifused and incubated dispersed rat pituitary cells and measuring TSH release by a specific R1A . ^^^ We conclude that the TSH releasing activity of histones H2A and H2B is mediated by calcium and diacylglycerol associated pathways . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Archaeal histones from mesophilic , thermophilic , and hyperthermophilic members of the Euryarchaeota have primary sequences , the histone fold , tertiary structures , and dimer formation in common with the eukaryal nucleosome core histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The authors report that histones H2A and H2B possess growth hormone ( GH ) releasing activity in vitro and describe the specificity and signal transduction pathways involved in these effects . ^^^ Perfusion of cells with 30 microM histone H2A or H2B , generated significant GH secretory responses . ^^^ Pituitary cell incubation with 30 microM forskolin alone or in the presence of H2A or H2B , stimulated GH release in the same magnitude . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using recombinant histones , we have now assembled the MMTV promoter in particles containing either an octamer of the histones H 3 , H 4 , H2A and H2B or a tetramer of histones H 3 and H 4 , and have compared the two particles in terms of structure , positioning , and exclusion of transcription factors . ^^^ The same two main positions are found for particles containing only the H3 / H4 tetramer , showing that the absence of H2A / H2B dimers does not alter positioning . ^^^ These results are compatible with a hormone induced removal of histone H2A / H2B during MMTV induction . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone H2A cross links to DNA in the core at the dyad axis , and histones H2A and H2B have extensive interactions with DNA 40 80 bp away from the dyad axis . ^^^ In the presence of linker histone , cross linkings of H 4 within 15 bp to one side of the dyad axis , of histone H2A at the dyad axis , and of H2A and H2B 40 80 bp to one side of the dyad axis are all reduced . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In an attempt to determine the profile and clinical association of anti histone antibody ( AHA ) , 45 Japanese AIH patients were studied for serum isotypic reactivity with individual histones ( H 1 , H2A , H2B , H 3 , H 4 ) by enzyme linked immunosorbent assay and western blotting . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
RAD 6 , an rhp 6 homolog in S . cerevisiae , is required for postreplication DNA repair and ubiquitination of histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Southern blot experiments and the molecular characterization of the genomic fragment containing the H2A , H2B , H 3 and H 4 genes showed that they are organized in a cluster with an orientation different from the one found in other dipterans . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone DNA templates for bacteriophage T 7 RNA polymerase were assembled from a plasmid containing a promoter and a terminator for this polymerase , ( H 3 10 H 4 ) 2 tetramers deprived of their tail domains , and H2A 10 H2B dimers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Acetylation of histone H2B was low and of H2A was barely measurable . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
LBP p 40 binds DNA tightly through associations with histones H2A , H2B , and H 4 . ^^^ Using recombinant core histone molecules fused with glutathione S transferase ( GST ) , we demonstrate that histones H2A , H2B , and H 4 are capable of interacting with LBP p 40 , whereas H 3 is not . ^^^ These results suggest that association of LBP p 40 with histones H2A , H2B , and H 4 confers tight binding of LBP p 40 to chromatin DNA in the nucleus . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have determined the core histone residues acetylated in vitro by recombinant p 300 and PCAF within mononucleosomes . p 300 specifically acetylates all sites of histones H2A and H2B known to be acetylated in bulk chromatin in vivo but preferentially acetylates lysines 14 and 18 of histone H 3 and lysines 5 and 8 of histone H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It is a trimer formed by NF YA and two putative histone like subunits , NF YB and NF YC , showing similarity to histones H2B and H2A , respectively . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Although a large heterogeneity of the humoral responses against these proteins was found , histones H2A and H 3 seem to be more prevalent immunogens than histones H2B and H 4 during canine natural leishmaniasis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The human H2A and H2B histone gene complement . ^^^ Sequences and expression patterns of newly isolated human histone H2A and H2B genes and the respective proteins were compared with previously isolated human H2A and H2B genes and proteins . ^^^ Altogether , 15 human H2A genes and 17 human H2B genes have been identified . 14 of these are organized as H2A / H2B gene pairs , while one H2A gene and three H2B genes are solitary genes . ^^^ Two H2A genes and two H2B genes turned outto be pseudogenes . ^^^ The 13 H2A genes code for at least 6 different amino acid sequences , and the 15 H2B genes encode 11 different H2B isoforms . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using a glutathione S transferase pull down assay we show that Gcn5p binds the amino terminal tails of histones H 3 and H 4 , but not H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Ubp M may deubiquitinate one or more critical proteins that are involved in the condensation of mitotic chromosomes , possibly acting selectively on histones H2A and H2B , the major ubiquitinated proteins of chromatin . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The tail domain of lamin Dm 0 binds histones H2A and H2B . ^^^ Isolated polynucleosomes , nucleosomes , histone octamer , histone H2A / H2B dimer , and histones H2A or H2B displaced the binding of lamin Dm 0 tail to chromosomes . ^^^ Taken together , these results suggest that the interaction between the tail domain of lamin Dm 0 and histones H2A and H2B may mediate the attachment of the nuclear lamina to chromosomes in vivo . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Molecular weight determinations of the H 5 , H 3 , H 4 , H2a , and H2b , with final errors of + / 1 Da or less , seem to eliminate histone modifications as the basis of anucleolytic pyknosis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Anti histone antibody is employed to localize exposed nucleosomal histones ( H 1 , H2a , H2b , H 3 and H 4 ) rather than tagging the cut ends of fragmenting DNA as in conventional technique . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
One of the two sera showed IgM anti histone antibodies in the enzyme linked immunosorbent assay reacted with H 1 , H2A , H2B , H 3 , and H 4 , whereas the other serum reacted with no fractions of total histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This revealed a complex comprising histones H2A , H2B , H 3 , and H 4 and DNA fragmented into 180 base pair units characteristic of mono , di , tri , and polynucleosomes , a pattern of fragmentation similar to that found in apoptotic cells . ^^^ It was found that sulfated polysaccharides bound to nucleosomes via the N termini of histones , especially H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Since NF Y is a trimer containing two subunits with high resemblance to histones H2B and H2A , we have investigated the effect of ET 743 on nucleosome reconstitution . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
To gain insight into how sugar chain processing events modulate endoplasmic reticulum ( ER ) / proteasomal degradation we looked at human asialoglycoprotein receptor polypeptides H2a and H2b , variants which differ only by an extra pentapeptide ( EGHRG ) present in H2a . ^^^ Membrane bound H2a is a precursor of a soluble secreted form while H2b reaches the plasma membrane . ^^^ Uncleaved precursor H2a molecules are completely retained in the ER and degraded as well as a portion of H2b . ^^^ In contrast , inhibition of glucose trimming with castanospermine greatly enhanced the degradation rate of H2a but not that of H2b . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
To investigate the in vitro transcription by bacteriophage T 7 RNA polymerase of oligonucleosomes lacking histone H2A 10 H2B dimers , templates were assembled from histone ( H 3 10 H 4 ) ( 2 ) tetramers with and without the complementary amount of H2A 10 H2B dimers and two different DNA species : pGEMEX 1 , devoid of nucleosome positioning sequences , and T 7 207 18 , which contains downstream from the promoter 18 tandem repeats of a 207 bp positioning sequence . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
RESULTS : Tip 60 significantly acetylates amino terminal tail peptides of histones H2A , H 3 and H 4 , but not H2B , consistent with substrate preference on intact histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chlamydomonas histones fractionated by high performance liquid chromatography revealed minor components ( histone variants ) for H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
To find out the causes of its fate we studied folding of H2a precursor , which was very similar to that of its alternatively spliced variant H2b which can exit to the Golgi . ^^^ Whereas these homooligomers accumulated for H2b they were degraded for H2a . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have traced transcription of histones H2A , H2B and H 3 as the parasite progresses through different developmental stages rings , trophozoites , schizonts and gametocytes . ^^^ We also found a markedly elevated level of H 3 transcript in the schizont stage parasite , while H2A and H2B were made in approximately equivalent amounts ( in trophozoites , schizonts and garnetocytes ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Synthetic peptides corresponding to regions within the amino terminal domains of the core histones H2A , H2B , H 3 , and H 4 , in which epsilon acetyllysine has been substituted for selected lysines , have been used to raise polyclonal antisera in rabbits . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The expression of human H2A H2B histone gene pairs is regulated by multiple sequence elements in their joint promoters . ^^^ The majority of human H2A and H2B histone genes are organized as gene pairs : 14 H2A H2B gene pairs , one solitary H2A gene and three solitary H2B genes have been described . ^^^ Two of the H2A genes and two of the H2B genes arranged within gene pairs are pseudogenes . ^^^ The gene pairs are organized with divergent transcriptional orientation , and the coding regions of the respective H2A and H2B genes are separated by about 320 nucleotide pairs that form overlapping promoter regions . ^^^ Comparison of promoters of H2A H2B gene pairs has previously shown that these belong to two different groups ( groups 1 and 2 ) which are characterized by specific patterns of conserved sequence elements . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Like many other H2B genes , sH2B 2 gene was closely linked to H2A gene whereas H 3 gene was located upstream of sH2B 3 gene . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 1 , H2a , H2b , H 3 , and H 4 from calf thymus were biotinylated using sulfosuccinimidobiotin at pH 7 . 5 . ^^^ The stoichiometries of biotinylation ( mol biotin / mol histone ) were as follows : H 1 , 3 . 9 + / 0 . 17 ; H2a , 1 . 7 + / 0 . 11 ; H2b , 1 . 8 + / 0 . 11 ; H 3 , 0 . 029 + / 0 . 0012 ; H 4 , 0 . 006 + / 0 . 0002 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We also demonstrate , using a combination of mass spectrometry , tandem mass spectrometry , and proteolytic digestion , that recombinant HOS 3 has a distinct specificity in vitro for histone H 4 sites K 5 and K 8 , H 3 sites K 14 and K 23 , H2A site K 7 , and H2B site K 11 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We examined a small region of the histone repeat , including the intergenic spacer segments of coding regions from the divergently transcribed H2A and H2B histone genes . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A , H 3 , and H2B have 0 . 2 , approximately 2 , and > 2 acetylated lysines per molecule , respectively , distributed across 2 , 5 , and 6 sites . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A tandemly repeated unit of 6553 bp containing a copy of the four core histone genes H2B , H2A , H 3 , and H 4 , and also a 5S rRNA gene , was amplified by PCR from genomic DNA of the isopod crustacean Asellus aquaticus . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The deduced amino acid sequence of each clone shows only between 40 % and 50 % identity with the H2A , H2B and H 3 somatic core histones of other plant species . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In dividing cells , newly synthesized DNA is rapidly assembled into chromatin by the deposition of a tetramer of the histone proteins H 3 and H 4 , followed by the deposition of two dimers of histones H2A and H2B to complete the nucleosome the fundamental repeating unit of chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In our present studies we used surface plasmon resonance measurements to demonstrate that Hsp 90 binds histones H 1 , H2A , H2B , H 3 and H 4 with high affinity having dissociation constants in the submicromolar range . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Among the four nucleosomal core histones ( H2A , H2B , H 3 , and H 4 ) , H2B , which is not usually phosphorylated in quiescent or growing cells , was found to be phosphorylated after treatment with various apoptotic inducers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Run on experiments indicated that transcription rates of the genes coding for the four core histones ( H2A , H2B , H 3 and H 4 ) were not affected by the inhibition with hydroxyurea of DNA synthesis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Sequence analysis of p 52 cDNA from congenic mouse strains detected an amino acid polymorphism at position 209 , which results in the substitution of a threonine in the H2b haplotype to a methionine in the H2a , d haplotypes . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Since only a single tail or a subset of tails may be primarily responsible for this effect , we determined whether removal of the individual tail domains of the H2A H2B dimer or the H 3 H4 tetramer affects TFIIIA binding to its cognate DNA site within the 5S nucleosome in vitro . ^^^ The results show that the tail domains of H 3 and H 4 , but not those of H2A and / or H2B , directly modulate the ability of TFIIIA to bind nucleosomal DNA . ^^^ Thus , TFIIIA binding occurs by displacement of H2A H2B DNA contacts but without complete loss of the dimer from the nucleoprotein complex . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
METHODS : The binding properties of LEC+ and LEC SLE sera to chromatin associated nuclear antigens ( histones H 1 , H2A , H2B , H 3 , H 4 ; complexes of H2A H2B , [ H2A H2B ] DNA , H 1 DNA ; total and H 1 stripped chromatin ; native and denatured DNA ) were investigated . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast neither removal or hyperacetylation of H 3 and H 4 tails nor removal or hyperacetylation of H2A and H2B N terminal tails affected the nucleosome structure . ^^^ This indicates that the globular domain of H2A and H2B is sufficient to stabilize the tailless or the hyperacetylated ( H 3 H4 ) ( 2 ) tetramer in a left handed superhelix conformation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B are known to be reversibly post translationally modified by ubiquitination . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The hyperthermophilic archaeon Methanothermus fervidus contains two small basic proteins , HMfA ( 68 amino acid residues ) and HMfB ( 69 residues ) that share a common ancestry with the eukaryal nucleosome core histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Studies on the prolactin releasing mechanism of histones H2A and H2B . ^^^ We have now studied the specificity and signal transduction pathways involved in the prolactin ( PRL ) releasing activity of histones H2A and H2B on perifused and incubated rat pituitary cells . ^^^ Perifusion of cells with median eminence extract ( 1 / 30 ) , histone H2A ( 30 microM ) or histone H2B ( 30 microM ) , generated clear PRL release responses . ^^^ Cells incubated with histone H2A and H2B showed a dose and time dependent stimulatory effect on PRL release which , for H2A , was blocked by peptide MB 35 , an 86 120 amino acid synthetic fragment of histone H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The structure of the nucleosomes reconstituted with recombinant CENP A , histones H2A , H2B , and H 4 , and closed circular DNAs had the following properties . ^^^ Mononucleosomes isolated by glycerol gradient sedimentation had a relative molecular mass of approximately 200 kDa and were composed of 120 150 bp of DNA and equimolar amounts of CENP A , and histones H 4 , H2A , and H2B . ^^^ Thus , we conclude that CENP A forms an octameric complex with histones H 4 , H2A , and H2B in the presence of DNA . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Exposure of individual histone proteins ( H 1 , H2A , H2B , H 3 , or H 4 ) and histone octamers ( consisting of two molecules each of H2A , H2B , H 3 , and H 4 ) to hydroxyl radicals , generated by gamma irradiation , in the presence of O ( 2 ) generates protein bound hydroperoxides in a dose dependent fashion ; this is in accord with previous studies with other proteins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Calf histones H2A and H 4 and bovine myelin basic protein were methylated by Hsl7p , whereas histones H 1 , H2B , and H 3 and bovine cytochrome c were not . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Genes coding for the core histones H2a , H2b , H 3 , and H 4 of Giardia lamblia were sequenced . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The in vitro immunoprecipitation experiment established that chp 46 interacts with histones H2B and H 4 and chicken histone acetyltransferase 1 , chHAT 1 , whereas hup 46 interacts with histones H2A and H 4 and chHAT 1 and chCAF 1p48 with histone H 4 and chHAT 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The basic unit of chromatin is the nucleosome , which is made up of 146 base pairs of DNA wrapped around two of each of four core histones , H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Our data showed that spermatogonia and preleptotene spermatocytes contained acetylated core histones H2A , H2B and H 4 , whereas no acetylated histones were observed throughout meiosis in leptotene or pachytene spermatocytes . ^^^ Acetylated forms of H2A and H2B , H 3 and H 4 reappeared in step 9 to 11 elongating spermatids , and disappeared later in condensing spermatids . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Classic members of the SPT gene family , SPT 11 , SPT 12 , and SPT 15 , encode for the histones H2A and H2B , and for TATA binding protein ( TBP ) , respectively . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
All histones were labeled by all drug preparations , with H2A being the principal site of methylation and H2B , H 3 and H 1 being the major targets of carbamoylation and guanidination . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The four core histones H2A , H2B , H 3 and H 4 are transported from the cytoplasm into the nucleus by a receptor mediated and energy dependent process . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chromatin is composed of DNA wrapped around a nucleosome core ( consisting of two copies of the well conserved histones H2A , H2B , H 3 , and H 4 ) and a more variable linker histone H 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Nuclear import of histone H2A and H2B is mediated by a network of karyopherins . ^^^ The core histones include H2A and H2B , which are assembled into nucleosomes as heterodimers . ^^^ We show here that the import of histone H2A and H2B is mediated by several members of the karyopherin ( Kap ; importin ) family . ^^^ An abundant complex of H2A , H2B , and Kap114p was detected in cytosol . ^^^ In addition , two other Kaps , Kap121p and Kap123p , and the histone chaperone Nap1p were isolated with H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The most abundant ProT alpha binding proteins were histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
On average , acetylation half lives were approximately 15 min for histone H 4 , 10 min for histone H 3 , 4 min for histone H2B , and 5 min for histone H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Labeling of some residues ( e . g . , Gln ( 104 ) and Gln ( 112 ) of H2A ) requires the unwinding of DNA and the dissociation of the H2A H2B dimers . ^^^ Gln ( 76 ) of H 3 is labeled in the H 3 H 4 tetramer only when the H2A H2B dimers are dissociated . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Recombinant Bdf1p ( rBdf1p ) demonstrates binding affinity for histones H 4 and H 3 but not H2A and H2B in vitro . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Chromatin docking and exchange activity enhancement of RCC 1 by histones H2A and H2B . ^^^ We find that RCC 1 binds directly to mononucleosomes and to histones H2A and H2B . ^^^ We propose that the docking of RCC 1 to H2A / H2B establishes the polarity of the Ran GTP gradient that drives nuclear envelope assembly , nuclear transport , and other nuclear events . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B form part of the same nucleosomal structure as H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The N termini of NC 2 alpha and beta resemble histones H2A and H2B , respectively , and form a heterodimer that binds to the bent DNA double helix on the underside of the preformed TBP DNA complex via electrostatic interactions . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Nuclear import of the four core histones H2A , H2B , H 3 and H 4 is one of the main nuclear import activities during S phase of the cell cycle . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We have developed a highly specific antibody set for acetylation sites in yeast histones H 4 ( K 5 , K 8 , K 12 , and K 16 ) ; H 3 ( K 9 , K 14 , K 18 , K 23 , and K 27 ) ; H2A ( K 7 ) ; and H2B ( K 11 and K 16 ) . ^^^ At the INO 1 promoter , RPD 3 is required for strongly deacetylating all sites except H 4 K16 , ESA 1 for acetylating H2A , H2B , and H 4 sites except H 4 K16 , and GCN 5 for acetylating H2B and H 3 sites except H 3 K14 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Consistent with these observations and with sequence relationships of hTAF ( 2 ) 20 and hTAF ( 2 ) 135 to histones H2B and H2A , respectively , TFIID preparations that contain higher levels of hTAF ( 2 ) 135 also contain higher levels of hTAF ( 2 ) 20 , and the interaction between hTAF ( 2 ) 20 and hTAF ( 2 ) 135 is critical for human TFIID assembly in vitro . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here , human cells were found to covalently bind biotin to histones H 1 , H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition , when competitor nucleosome particles were reconstituted with full length H2A , H2B and H 4 and histone H 3 mutated at the phosphorylable serine 10 or serine 28 , their inhibiting efficiency was identical to that of the native particles . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By matching masses of unique peptides with full length masses , H 4 and the variants H2A . 1 , H2B . 1 , and H3 . 1 were identified as the main histone forms in K 562 cells . ^^^ Histones H2A , H 3 , and H 4 underwent changes in mass consistent with altered acetylation and phosphorylation , whereas H2B mass was largely unchanged . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Enzymatic deubiquitination of mono ubiquitinated nucleosomal histone H2A ( uH2A ) and H2B ( uH2B ) is closely associated with mitotic chromatin condensation , although the function of this histone modification in cell division remains ambiguous . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H2B do exchange out of chromatin , but do so predominantly during transcription . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A ( H2a ) > B 6 ( H2b ) strain combination . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Although preliminary , our in vitro experiment suggests that the target of tTGase is core histones : H2A : H2B and H 3 : H 4 are specifically crosslinked by tTGase . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We report here that in response to apoptotic signals from a death receptor ( CD 95 and tumor necrosis factor alpha ) or mitochondrial ( staurosporine ) apoptotic stimulus , the core nucleosomal histones H2A , H2B , H 3 , and H 4 become separated from DNA during apoptosis in Jurkat and HeLa cells and are consequently detectable in the cell lysate prepared using a non ionic detergent . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This group of small very basic proteins consists of the H 1 linker histones and the core histones H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Characterization of these proteins revealed that they are identical to histones H2A and H2B . ^^^ Histones H2A and H2B showed dose dependent inhibition of the endotoxin activity of LPS and inhibited this activity by binding to and therefore blocking both the core and lipid A moieties of LPS . ^^^ Consistent with a role for histones in the establishment of placental innate defense , histones H2A and H2B were highly expressed in the cytoplasm of syncytiotrophoblasts and amnion cells , where the histone proteins were localized mainly to the epithelial surface . ^^^ Furthermore , culturing of amnion derived WISH cells led to the constitutive release of histone H2B , and histones H2A and H2B contribute to bactericidal activity of amniotic fluid . ^^^ Our studies suggest that histones H2A and H2B may endow the epithelium of the placenta with an antimicrobial and endotoxin neutralizing barrier against microorganisms that invade this immune privileged site . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The sequence of the stem loop in the Drosophila melanogaster histone H2b , H 3 , and H 4 genes is identical to the consensus sequence of other metazoan histone mRNAs , but the sequence of the stem loop in the D . melanogaster histone H2a and H 1 genes is novel . dSLBP binds to these novel stem loop sequences as well as the canonical stem loop with similar affinity . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition to the previously identified pair of genes that encode histones H 3 and H 4 ( hH 3 and hH 4 1 ) , we identified a second histone H 4 gene ( hH 4 2 ) , a divergently transcribed pair of genes that encode H2A and H2B ( hH2A and hH2B ) , a homolog of the F / Z family of H2A variants ( hH2Az ) , a homolog of the H 3 variant CSE 4 from Saccharomyces cerevisiae ( hH3v ) , and a highly diverged H 4 variant ( hH4v ) not described in other species . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A repeating unit of the histone gene cluster from Drosophila simulans containing the H 1 , H2A , H2B and H 4 genes ( the H 3 gene region has already been analyzed ) was cloned and analyzed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
There are three naturally occurring H 2 splice variants , designated H2a , H2b , and H2c , although the expression of the H2c protein had not been reported . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
New experiments using antibodies , green fluorescent protein fusions , and epitope tags show that CENP A replaces the major histone H 3 subunits in a specialized histone octamer and that it does so with histones H 4 , and probably H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 1 , H 3 , H2A , and H2B can be ubiquitinated in vivo , but the most prevalent are uH2A and uH2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using co fractionation and co immunoprecipitation we demonstrate that hDaxx associates with proteins that are critical for transcriptional repression , such as histone deacetylase 2 , constituents of chromatin such as core histones H2A , H2B , H 3 and H 4 , and Dek , a chromatin associated protein reported to change the topology of DNA in chromatin in vitro . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The fundamental unit of eukaryotic chromatin , the nucleosome , consists of genomic DNA wrapped around the conserved histone proteins H 3 , H2B , H2A and H 4 , all of which are variously modified at their amino and carboxy terminal tails to influence the dynamics of chromatin structure and function for example , conjugation of histone H2B with ubiquitin controls the outcome of methylation at a specific lysine residue ( Lys 4 ) on histone H 3 , which regulates gene silencing in the yeast Saccharomyces cerevisiae . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A histone mixture ( H 1 , H2A , H2B , H 3 , and H 4 ) derived from calf thymus stimulated IgM production by human human hybridoma HB4C5 cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The passage of RNA polymerase 2 across eukaryotic genes is impeded by the nucleosome , an octamer of histones H2A , H2B , H 3 and H 4 dimers . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Anti histone H 4 antibodies ( but not H2A , H2B , or H 3 antibodies ) quantitatively immunoadsorbed type 2 binding sites from nuclear extracts . ^^^ Binding analyses by [ 3H ] estradiol exchange , using luteolin as a competitor , detected specific type 2 binding activity to histone H 4 ( but not histones H2A , H2B , or H 3 ) generated in a rabbit reticulocyte lysate translation system and confirmed that histone H 4 is the type 2 site . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using histone like genes in archaebacteria as outgroups , we also showed that H 1 , H2A , H2B , H 3 , and H 4 histone genes in eukaryotes form separate clusters and that these classes of genes diverged nearly at the same time , before the eukaryotic kingdoms diverged . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Remodeling of sperm chromatin after fertilization involves nucleosomes formed by sperm histones H2A and H2B and two CS histone variants . ^^^ It was found that these nucleosomes are organized by a core formed by sperm histones H2A and H2B combined with two major CS histone variants . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We found core histone subunits , H2A and H2B , were specifically cross linked by tTGase . ^^^ The cross linking was between either one or both glutamines at C terminal end of H2A ( VTIAQ 104 GGVLPNTQ112 SVLLPKKTESSKSK C ' end ) and the first and / or third lysine from C terminal end of H2B ( AVESEGK 116 AVTKYTSSK125 C ' end ) . ^^^ Most interestingly , in chicken erythrocyte the cross linked H2A H2B was present in a significant amount . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The nucleosome constitutes the central structure of chromatin and comprises two chains each of histones H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The contacts of unique residues in the histone fold regions of H 4 , H2B , and H2A with DNA were determined with base pair resolution before and after chromatin remodeling by a site specific photochemical cross linking approach . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In contrast , both the mouse and human H2a and H2b proteins consist of at least 10 non allelic variants , making the complexity of the histone protein complement significantly greater than previously thought . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Moreover , H 3 and H 4 show H2A and H2B tail independent acetylation in chromatin , whereas maximal H2A and H2B acetylation in this context is dependent upon H 3 and H 4 tails ( but not their acetylation ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
At a total length of 3 . 5 kb , the H 3 , H 4 , H 1 , H2A , and H2B quintet cluster is the most compact described thus far , but despite very rapid early developmental cleavage cycles , no extensive tandem repeats of the cluster were present . ^^^ The high degree of variation within each of the complements of O . dioica H2A and H2B subtypes resembled that found in plants as opposed to more closely related vertebrate and invertebrate species , and developmental stage specific expression of different subtypes was observed . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Microbore C ( 4 ) HPLC separated the core histones into H2A , H2B , H 3 and H 4 using HFBA as the ion pairing agent . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A role for nucleosome assembly protein 1 in the nuclear transport of histones H2A and H2B . ^^^ Here we demonstrate that nucleosome assembly protein 1 ( Nap1p ) , a protein previously implicated in the deposition of histones H2A and H2B , is also involved in the transport of these two histones . ^^^ We demonstrate that Nap1p can bind directly to Kap114p , the primary karyopherin / importin responsible for the nuclear import of H2A and H2B . ^^^ Furthermore , we demonstrate that Nap1p promotes the association of the H2A and H2B NLSs specifically with the karyopherin Kap114p . ^^^ We propose a model in which Nap1p links the nuclear transport of H2A and H2B to chromatin assembly . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here we examine Escherichia coli protein H NS and calf thymus histones , H 1 , H2A , H2B , H 3 , and H 4 , for the presence of cPHB . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In agreement with predictions , hTAF 12 forms a histone fold that is very similar to that of histone H2B , yet unexpected differences are observed between the structures of the hTAF 12 interaction domain of hTAF 4 and histone H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Z , BRE 1 , RAD 6 , and LGE 1 are each essential for cell viability , supporting redundant functions for H2B ubiquitination and H2A substitution in the formation of active chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Inhibition of histone deacetylation with TSA is accompanied by a decrease in the abundance of ZmGCN 5 acetylase protein , but by increases in mRNAs for histones H2A , H2B , H 3 and H 4 . ^^^ The ZmGCN 5 antisense material showed suppression of the endogenous ZmGCN 5 transcript and the profiling analysis revealed increased mRNA levels for H2A , H2B and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Extending the study , we found that histones H 1 , H2A , H2B , H 3 , and H 4 from calf thymus are all able to bind LPS . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The ELISAs were based on either one of the following Leishmania antigens : crude soluble Leishmania antigens ( SLAs ) , recombinant ( r ) antigens ( namely : rgp 63 , rK 39 , gene B protein , r H2A and r H2B histones proteins , rLACK , rPSA 2 , r P 20 ) and purified lipophosphoglycan . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Our results show that the N terminal tails of H2A and H2B , but not of H 3 and H 4 , make internucleosomal histone DNA interactions within the dinucleosome . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In frogs , nucleoplasmin is required to assemble histones H2A and H2B onto the paternal chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The N terminal tails of the H2A H2B histones affect dimer structure and stability . ^^^ To elucidate the effects of the N terminal tails on the structure and stability of histones , the highly charged N terminal tails were truncated from the H2A and H2B histones . ^^^ Three mutant dimers were studied : DeltaN H2A / WT H2B ; WT H2A / DeltaN H2B , and DeltaN H2A / DeltaN H2B . ^^^ The data support four conclusions regarding the effects of the N terminal tails of H2A and H2B : ( 1 ) Removal of the N terminal tails of H2A and H2B enhance the helical structure of the mutant heterodimers . ( 2 ) Relative to the full length WT heterodimer , the DeltaN H2A / WT H2B dimer is destabilized , while the WT H2A / DeltaN H2B and DeltaN H2A / DeltaN H2B dimers are slightly stabilized . ( 3 ) The truncated dimers exhibit decreased m values , relative to the WT dimer , supporting the hypothesis that the N terminal tails in the isolated dimer adopt a collapsed structure . ( 4 ) Electrostatic repulsion in the N terminal tails decreases the stability of the H2A H2B dimer . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We found that , although BRD 7 binds to histones H2A , H2B , H 3 and H 4 through its bromodomain , this domain was not necessary for the interaction with E1B AP 5 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Interestingly , it contains a histone fold motif similar to that of histone H2A , and like histone H2A , it interacts strongly with histone H2B in vitro . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
HiNF D interacts with all five classes ( H 1 , H2A , H2B , H 3 , and H 4 ) of the cell cycle dependent histone genes , which are transcriptionally and coordinately activated at the G ( 1 ) / S phase transition independent of E2F . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone variants such as histone H3 . 3 , H2AX , and macroH2A appear to play key roles in the various stages of spermiogenesis , in addition to the specifically modulated acetylation of histone H 4 ( acH 4 ) , ubiquitination of histones H2A and H2B ( uH2A , uH2B ) , and phosphorylation of histone H 3 ( H3p ) . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
DNA or histone sulphate containing the histones H 1 , H2A , H2B , H 3 and H 4 were dissolved in cationic and anionic buffers ( Tris , phosphate ) at different pH values ( pH 8 . 0 , 7 . 4 and 7 . 0 ) and titrated with EGCG ( epigallocatechin gallate ) or catechin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A growing body of biochemical and genetic evidence clearly links the unique combinatorial patterning of side chain acetylation , methylation , and phosphorylation mainly within the highly conserved N termini of histones H2A , H2B , H 3 , and H 4 with the regulation of gene expression and chromatin assembly and remodeling , in effect constituting a `` histone code ' ' for epigenetic signaling . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The histone H2A , H2B , and H 3 genes and a partial sequence of the histone H 4 gene from Plasmodium falciparum have been previously identified and share a high level of nucleotide sequence identity . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In synthetic genetic array ( SGA ) analysis , synthetic growth defects were obtained when a set 2 deletion was combined with deletions of all five components of the Paf 1 complex , the chromodomain elongation factor Chd 1 , the putative elongation factor Soh 1 , the Bre 1 or Lge 1 components of the histone H2B ubiquitination complex , or the histone H2A variant Htz 1 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
N terminal sequencing and immunoblotting with anti histone antibodies confirmed the presence of both intact and proteolytically cleaved somatic histones H 3 , H2B , H2A , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A ( H2a ) > B 6 ( H2b ) strain combination using depleting anti T cell monoclonal antibodies ( mAbs ) , cyclophosphamide , and thymic irradiation . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
To better understand the latter process , we have used sedimentation velocity , sedimentation equilibrium , and sucrose gradient fractionation analysis to show that the pentameric form of nucleoplasmin binds to a histone octamer equivalent consisting of equal amounts of the four core histones , H2A , H2B , H 3 , and H 4 , without any noticeable preference for any of these proteins . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
It consists almost entirely of repeating units , called nucleosomes , in which short segments of DNA are wrapped tightly around a disk like structure comprising two subunits of each of the histone proteins H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The three helix , approximately 65 residue histone fold domain is the most structurally conserved part of the core histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Apoptosis was assessed by flow cytometry , by DNA fragmentation and by accumulation of histones , H2A , H2B , R 3 and H 4 , in the nucleoplasm of cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The histones H2A , H2B , H 3 and H 4 are very conserved basic proteins that wrap almost two turns of DNA to form the nucleosome core . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The repeating units of the histone gene cluster containing the H 1 , H2A , H2B and H 4 genes were amplified by PCR from the Drosophila melanogaster species subgroup , i . e . , D . yakuba , D . erecta , D . sechellia , D . mauritiana , D . teissieri and D . orena . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Tying C ' ends of H2A and H2B using a molecular glue , tissue type transglutaminase . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Jurkat cells treated with DPCPX underwent apoptosis as demonstrated by flow cytometry , by DNA fragmentation and by accumulation of histones , H2A , H2B , H 3 and H 4 , in the nucleoplasm of cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Adding a mixture containing the five nucleosomal histones , H 1 , H2A , H2B , H 3 and H 4 , as well as each of the last four individual histones to intact HeLa and Colo 205 cultured cells resulted in cell penetration and nuclear import of these externally added histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The budding yeast CENP C homologue Mif2p specifically copurified with histones H2A , H2B , and H 4 , and with the histone H 3 like CENP A homologue Cse4p , strongly suggesting that Cse4p replaces histone H 3 in a specialized centromeric nucleosome . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In confirmation of previous studies , we found that the histones H 4 , H2A , and H2B were synthesized almost exclusively in the late G 1 and early S phases . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This protein is a chromosome associated NAD dependent enzyme which , in contrast to other known proteins of this family , catalyses both ADP ribosylation and deacetylation of histones , particulary H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Western blot analysis revealed a downregulation of all 5 histone subtypes ( H 1 , H2A , H2B , H 3 , and H 4 ) at 1 day and there was a subsequent induction of H 1 and H2A subtypes at 3 days after injury . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone deacetylase ( HDAC ) inhibitors are a new class of cancer chemotherapeutics in clinical development that target the family of enzymes that catalyze the removal of the acetyl modification on lysine residues of proteins , including the core nucleosomal histones H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The cell cycle dependent expression of the four core histones ( H2A , H2B , H 3 and H 4 ) has been studied in the protozoan parasite Leishmania infantum . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Using asialoglycoprotein receptor H2a and H2b as models , we determined in pulse chase experiments that both glycoproteins initially bind to calnexin and ERp 57 . ^^^ However , H2b , which will exit to the Golgi , dissociated from calnexin and remained bound for a longer period to ERp 57 , whereas the opposite was true for the endoplasmic reticulum associated degradation substrate H2a that will go to the endoplasmic reticulum derived quality control compartment . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone release during transcription : NAP 1 forms a complex with H2A and H2B and facilitates a topologically dependent release of H 3 and H 4 from the nucleosome . ^^^ It was first determined in competition experiments between DNA and RNA that histones H2A and H2B have a 20 fold preference for binding RNA over DNA ; a preference was not seen for histones H 3 and H 4 . ^^^ Histones H 3 and H 4 would preferentially bind RNA , provided they were in an octameric complex with H2A and H2B . ^^^ Histones H 3 and H 4 would be released from this template when H2A and H2B were present , a release that was enhanced by the presence of nucleosome assembly protein 1 ( NAP 1 ) . ^^^ Since a small quantity of H2A and H2B is sufficient to facilitate this transfer , it is proposed that H2A and H2B function to repeatedly shuttle H 3 and H 4 from the template DNA to the RNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Ubiquitylated histones have subsequently been found in many eukaryotic species , and to date , the core histones H2A , H2B , H 3 , the linker histone H 1 , and the histone variant H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
An extranuclear accumulation of the nucleosomal histones H2A , H2B , H 3 , and H 4 in cell lysates was observed very early in the process of apoptosis , even before phosphatidylserine externalization occurred on the outer membrane surface of apoptotically dying lymphoblasts . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The human histone H2A , H2B , and H 3 genes were expressed well in Escherichia coli cells , but the human histone H 4 gene was poorly expressed . ^^^ The H2A / H2B dimer and the H3 / H4 tetramer were refolded by dialysis against buffer without urea , and the hexahistidine tags of the histones in the H2A / H2B dimer and the H3 / H4 tetramer were removed by thrombin protease digestion . ^^^ The H2A / H2B dimer and the H3 / H4 tetramer obtained by this method were confirmed to be proficient in nucleosome formation by the salt dialysis method . ^^^ A new CENP A gene optimized for the E . coli expression system was also constructed , and we found that the purified recombinant CENP A protein formed a nucleosome like structure with histones H2A , H2B , and H4 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A decrease in histone subtypes H2A , H2B , H 3 , and H 4 , but not H 1 , was demonstrated 1 and 3 days after burn according to the results of Western blot . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Only H 3 was detected on Western blot while H 1 , H2A , H2B , and H 4 were not detected in human HCCs . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Recently we reported that mRNA levels of mammalian replication dependent histones , both linker histone H 1 and four core histones ( H2A , H2B , H 3 and H 4 ) , are coordinately downregulated in parallel with the inhibition of DNA synthesis upon DNA damage . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Core histones H2A , H2B , H 3 and H 4 , which were identified on the basis of amino acid sequencing and mass spectrometry data , showed conserved electrophoretic patterns . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
To understand the developmental origins of PT derived somatic histones during spermiogenesis , we used affinity purified antibodies against somatic type histones H 3 , H2B , H2A , and H 4 to probe bovine testicular tissue using three different immunolocalization techniques . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This review aims to summarise some of the experiments that demonstrated the global effects of the modifications of the five histone proteins , H 1 , H2A , H2B , H 3 and H4 . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
METHODS : Each histone class ( H 1 , H2A , H2B , H 3 , and H 4 ) was detected by western blot analysis with specific antibodies . ^^^ An additional significant increase of H2A , H2B , H 3 , H 4 , and complete nucleosomes in cell lysates of lymphoblasts was found during interleukin ( IL ) 2 deprivation for 8 or 24 hours . ^^^ Quantities of H2A , H2B , H 3 , and H 4 in cell lysates correlated significantly with signs of early apoptosis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Additionally , increase in the N nitroso immunoreactivity of preincubated histones H2A and H2B was detected by Western blot analysis . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In a first stage , the immune response elicited by the intramuscular injection of a mixture of four plasmid DNAs , encoding the L . infantum histones H2A , H2B , H 3 and H 4 , was determined in BALB / c mice . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
By Western blot analysis using rabbit anti ubiquitin antibodies , histone H2A and H2B were found to be the only proteins that are ubiquitinated in the acid extractable nuclear proteins of both young ( 4 month old ) and senescent ( 29 month old ) mouse brains . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
One example of such modification is ubiquitination , which mainly occurs on histones H2A and H2B . ^^^ Although recent studies have uncovered the enzymes involved in histone H2B ubiquitination and a ' cross talk ' between H2B ubiquitination and histone methylation , the responsible enzymes and the functions of H2A ubiquitination are unknown . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
RESULTS : Several potential auto T cell epitopes of core histone proteins ( H2A , H2B , H 3 , and H 4 ) were identified . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
TSA prominently increased the amount of acetylated histones , H 3 , H 4 , H2A and H2B , in p 815 mastocytoma cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
DNA instructed displacement of histones H2A and H2B at an inducible promoter . ^^^ Here , we show that progesterone treatment of cultured cells leads to recruitment of progesterone receptor ( PR ) and SWI / SNF related complexes to Mouse Mammary Tumor Virus ( MMTV ) promoter , accompanied by displacement of histones H2A and H2B from the nucleosome containing the receptor binding sites , but not from adjacent nucleosomes . ^^^ In nucleosomes assembled on MMTV or mouse rDNA promoter sequences , SWI / SNF catalyzes ATP dependent sliding of the histone octamer followed only on the MMTV promoter by displacement of histones H2A and H2B . ^^^ In MMTV nucleosome arrays , SWI / SNF displaces H2A and H2B from nucleosome B and not from the adjacent nucleosome . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We report that the Mdm 2 oncoprotein , a RING domain E 3 ubiquitin ligase known to ubiquitylate the p 53 tumor suppressor protein , can interact directly with histones and promote in vitro monoubiquitylation of histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
This conclusion was supported by the finding that the full set of core histones ( H2A , H2B , H 3 , H 4 ) are still present in sperm chromatin , but histone H 1 is replaced by its variant , H1V . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Variable region genes of human monoclonal autoantibodies to histones H2A and H2B from a systemic lupus erythematosus patient . ^^^ An antibody phage library obtained from peripheral blood lymphocytes of a systemic lupus erythematosus ( SLE ) patient was used to isolate four monoclonal autoantibodies against histones H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here we examined the DNA binding activity of TAF 9 , TAF 6 , TAF4b , and TAF 12 , which are related to histones H 3 , H 4 , H2A , and H2B , respectively . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The major antigens recognized by antihistone antibody are histones H 1 , H2A and H2B , which are located on the outer side of the nucleosome and are relatively more accessible for antibody binding . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In this study , high levels of core histone proteins H2A , H2B , H 3 and H 4 were found in hemocytes from the Pacific white shrimp , Litopenaeus vannamei . ^^^ Consequently , a 38 amino acid synthetic peptide identical to the N terminus of shrimp H2A was synthesized and assayed , along with endogenous histones H2A , H2B , and H 4 , for growth inhibition against Micrococcus luteus . ^^^ Histone H2A , purified to homogeneity , completely inhibited growth of the Gram positive bacterium at 4 . 5 microm while a mixture of histones H2B and H 4 was active at 3 microm . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The differences are more pronounced at the L 1 and L 2 loops of the respective monomers H2B and H2A , and at the N termini of the monomers H 3 and H 4 , all of which closely interact with the wrapping DNA . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here we demonstrate that Kap114p , the primary karyopherin / importin responsible for the nuclear import of histones H2A and H2B , modulates the deposition of histones H2A and H2B by the histone chaperone Nap1p . ^^^ We show that a complex comprising Kap114p , histones H2A and H2B , and Nap1p is present in the nucleus and that the presence of this complex is specifically promoted by Nap1p . ^^^ The inhibition of H2A and H2B deposition by Kap114p results in the concomitant inhibition of RCC 1 loading onto chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Among the intron less histone genes , only the H 3 genes adhere to the R 3 / G+4 rule , while the H 1 , H2A , H2B and H 4 genes usually lack either R 3 or G+4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The USP 7 GMPS complex catalyzed the selective deubiquitylation of histone H2B , but not H2A . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Indeed , a novel enzyme , E3Histone , which could conjugate ubiquitin to histones H 1 , H2A , H2B , H 3 , and H 4 in vitro , was found . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Z / H2B dimer is unstable compared to the dimer containing the major H2A isoform . ^^^ The nucleosome , the basic fundamental repeating unit of chromatin , contains two H2A / H2B dimers and an H3 / H4 tetramer . ^^^ Z / H2B dimer is compared to that of the H2A / H2B dimer . ^^^ Z / H2B and H2A / H2B are 7 . 3 kcal mol ( 1 ) and 15 . 5 kcal mol ( 1 ) , respectively , in 1 M TMAO . ^^^ Z / H2B dimer is the least stable histone fold characterized to date , while H2A / H2B appears to be the most stable . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The histones H2A / H2B and H3 / H4 are imported into the yeast nucleus by different mechanisms . ^^^ The essential Pse1p and the nonessential importins Kap114p , Kap104p , and Yrb4p / Kap123p specifically bind to histones H2A and H2B . ^^^ Import of green fluorescent protein fusions to H2A and H2B requires primarily Pse1p and Kap114p , whereas Yrb4p plays an auxiliary role . ^^^ We conclude from our in vivo and in vitro experiments that import of the essential histones is mediated mainly by the essential importin Pse1p , while the non essential Kap114p functions in a parallel import pathway for H2A and H2B . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We show that a reconstituted octamer consisting of hTSH2B and a stoichiometric complement of histones H2A , H 3 , and H 4 exhibits a lower stability compared to the reconstituted native counterpart consisting of H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Together with the demonstration that tobacco NAP 1 proteins bind histone H2A and H2B , our results support the current model and provide additional evidence that function of NAP 1 as histone chaperones appears to be conserved in plants . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H 1 , H2A , H2B , H 3 and H 4 are DNA binding proteins that mediate the folding of DNA into chromatin . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The nucleosome core particle is composed of a central tetramer of 2 molecules each of H 3 and H 4 flanked by 2 dimers of H2A and H2B and surrounded by 2 superhelical turns of approximately 146 base pairs of DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone release during transcription : displacement of the two H2A H2B dimers in the nucleosome is dependent on different levels of transcription induced positive stress . ^^^ The templates were reconstituted with ( 3 ) H labeled H2A , H2B , H 3 , and H 4 to form nucleosomes , and transcription was done with T 7 RNA polymerase in the presence of a negatively coiled competitor DNA ( reconstituted with unlabeled H 3 and H 4 ) . ^^^ The first of the two labeled H2A H2B dimers readily displaced from the highly positively coiled template to the competitor even in the absence of transcription , while the indirect effect of transcription induced stress was required for the moderately coiled template . ^^^ The second labeled H2A H2B dimer required transcription induced stress for both moderately and highly positively coiled DNA . ^^^ The displacement of the labeled H 3 H4 tetramer also occurred , provided it was associated with an H2A H2B dimer and a moderately positively coiled DNA . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Immunoblotting using antimodified citrulline antibody indicated that histones H2A , H 3 , and H 4 but not H2B were deiminated . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
SSTK phosphorylated histones H 1 , H2A , H2AX , and H 3 but not H2B or H 4 or transition protein 1 in vitro . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The yeast karyopherin Kap114p has previously been shown to import histones H2A and H2B , Nap1p , and a component of the preinitiation complex ( PIC ) , TBP . ^^^ We have also shown that Kap114p possesses multiple overlapping binding sites for its partners , Sua7p , Nap1p , and H2A and H2B , as well as RanGTP and nucleoporins . ^^^ In addition , we have assembled an in vitro complex containing Sua7p , Nap1p , and histones H2A and H2B , suggesting that this Kap may import several proteins simultaneously . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
ELISA based binding data also suggest that PfNAPS and PfNAPL preferentially interact with the H 3 H4 tetramer histones over H2A and H2B histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here we report that , in Xenopus eggs , the linker histone is associated with the Xenopus homologue of nucleosome assembly protein 1 ( NAP 1 ) , which is known to be a chaperone for the core histones H2A and H2B in Drosophila and mammalian cells [ Ito , T . , Bulger , M . , Kobayashi , R . & Kadonaga , J . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Here we show that near a DSB phosphorylation of H2A is followed by loss of histones H2B and H 3 and increased sensitivity of chromatin to digestion by micrococcal nuclease ; however , phosphorylation of H2A and nucleosome loss occur independently . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Characterization of histone H2A and H2B variants and their post translational modifications by mass spectrometry . ^^^ The nucleosome , the fundamental structural unit of chromatin , contains an octamer of core histones H 3 , H 4 , H2A , and H2B . ^^^ Here we report the first global mass spectrometric analysis of histone H2A and H2B variants derived from Jurkat cells . ^^^ A combination of mass spectrometric techniques , HPLC separations , and enzymatic digestions using endoproteinase Glu C , endoproteinase Arg C , and trypsin were used to identify histone H2A and H2B subtypes and their modifications . ^^^ We identified nine histone H2A and 11 histone H2B subtypes , among them proteins that only had been postulated at the gene level . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The HIRA deficiency caused slightly delayed cell growth and affected the opposite transcriptions of cell cycle related genes , i . e . repressions for P 18 , CDC25B , and BCL 2 , activations for P 19 and cyclin A , and histones H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The autoantibodies studied were : fluorescent ANA , anti double stranded DNA ( anti ds DNA ) , IgG and IgM anti cardiolipin ( ACA ) , anti histone H 1 and C ( H 1 , H2A , H2B , H 3 , H 4 ) , anti SSA , SSB , ENA , scleroderma 70 , thyroid peroxidase ( TPO ) and neutrophilic cytoplasmatic ( ANCA ) antibodies . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In eukaryotic cell nuclei , DNA associates with the core histones H2A , H2B , H 3 and H 4 to form nucleosomal core particles . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Phosphorylation of S 14 of histone H2B and poly ( ADP ribosylation ) of glutamate residues on histone H2A are known markers of DSB in DNA ; these modifications increased 10 40 min after alterations in K 12 biotinylation occurred . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In the present study , we demonstrated centromere specific nucleosome formation in vitro with recombinant proteins , including histones H2A , H2B , H 4 , CENP A , and the DNA binding domain of CENP B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Unfolding of heterochromatin requires , in addition to further cleavage of H 4 , extensive digestion of H2A and H2B , strongly suggesting that these histones stabilize the higher order structure by forming a protein network which extends throughout the heterochromatin domain . . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histone release during transcription : acetylation stabilizes the interaction of the H2A H2B dimer with the H 3 H4 tetramer in nucleosomes that are on highly positively coiled DNA . ^^^ A high level of the post translational modification , acetylation , is found on the N terminal regions of the core histones H2A , H2B , H 3 , and H 4 and is primarily located in the nucleosomes of active genes . ^^^ Acetylated ( 3 ) H labeled H2A H2B also preferentially displaced to the competitor , but in this instance , transcription induced stress on the highly positively coiled template was required . ^^^ The histone chaperone , NAP 1 , was found to facilitate the displacement of both H 3 H4 and H2A H2B . ^^^ Surprisingly , when acetylated H2A H2B and acetylated H 3 H4 were reconstituted together in the same nucleosomes , the displacement of acetylated H2A H2B was much reduced during transcription . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The database contains an updated collection of multiple sequence alignments for the four core histones ( H2A , H2B , H 3 , and H 4 ) and the linker histones ( H1 / H5 ) from a total of 975 organisms . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
BACKGROUND : Histones are short proteins involved in chromatin packaging ; in eukaryotes , two H2a H2b and H 3 H4 histone dimers form the nucleosomal core , which acts as the fundamental DNA packaging element . ^^^ For the prokaryotic histones , there is no direct structural counterpart in the nucleosomal core particle , while the pseudodimer from Sos proteins is very similar to the dimer formed by histones H2a and H2b . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Surprisingly , the core histone genes H2A , H2B , H 3 , and H 4 have been duplicated in the human lineage since our split with chimpanzee . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Pharmacodynamic changes in histone acetylation ( H2A , H2B , H 3 , and H 4 ) in three depsipeptide sensitive and three intrinsically resistant tumors followed a similar pattern ; maximal increases in histone acetylation occurred at 8 hours and were elevated for up to 96 hours . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
TG 2 was able to phosphorylate H 1 , H2A , H2B , H 3 , and H 4 histones in vitro . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Although we detected Rmt 1 dependent arginine methylation in vivo in purified yeast histones H2A , H2B , H 3 and H 4 , we found no evidence for Hsl 7 dependent methylation of endogenous yeast histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The distribution of endogenous A type lamins was altered by overexpression of the lamin A mutants , coexpression experiments revealing that aberrant localization of the N195K and R386K mutants had no effect on the subnuclear distribution of histones H2A or H2B , or on nuclear accumulation of H2A overexpressed as a DsRed 2 fusion protein . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
They target a family of enzymes which catalyse histone acetylation modifications , in particular for histones H2A , H2B , H 3 and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In addition , we described three major changes in histone modification of cells exposed to soluble nickel compounds : ( 1 ) loss of acetylation of H2A , H2B , H 3 and H 4 ; ( 2 ) increases of H3K9 dimethylation ; and ( 3 ) substantial increases of the ubiquitination of H2A and H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Surprisingly , the N terminal alanines of H2A , H2B , and H 4 , were mono methylated , a modification that has not been described previously for histones . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
We show that all four core histones are sumoylated and identify specific sites of sumoylation in histones H2A , H2B , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
A total of 32 acetylations , methylations , and ubiquitinations were located in the human histones H2A , H2B , H 3 , and H 4 , including seven novel modifications . ^^^ Triplicate LC MSMS runs at six different HDACi concentrations demonstrated that PXD 101 affects acetylation of histones H2A , H2B , H 3 , and H 4 in a site specific and dose dependent manner . ^^^ This unbiased analysis revealed that a relative increase in acetylated peptide from the histone variants H2A , H2B , and H 4 was accompanied by a relative decrease of dimethylated Lys ( 57 ) from histone H2B . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
In this report , we use a combination of conventional chromatography and anti SRCAP immunoaffinity chromatography to purify a native human SRCAP complex with a polypeptide composition similar to that of SWR C , and we show for the first time that this SRCAP containing complex supports ATP dependent exchange of histone dimers containing H2B and H2A . ^^^ Z into mononucleosomes reconstituted with recombinant H2A , H2B , H 3 , and H 4 . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
As expression of histone proteins ( H2A , H2B , H 3 , H 4 ) are restricted to the synthetic phase of the cell cycle , hybridization for histone mRNA precisely distinguishes those cells in the S phase . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
The tails of core histones ( H2A , H2B , H 3 and H 4 ) are critical for the regulation of chromatin dynamics . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Ni ( 2 ) affects ubiquitination of core histones H2B and H2A . ^^^ Previously , we found that exposure of cells to Ni ( 2 ) resulted in truncation of histones H2A and H2B and thus elimination of some modification sites . ^^^ Here , we investigated the effect of Ni ( 2 ) on one such modification , ubiquitination , of histones H2B and H2A in nuclei of cultured 1HAEo and HPL1D human lung cells . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Unexpectedly , histones H2A , H2Av , and H2B were present . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
Histones H2A and H 4 were dramatically up regulated and the acetylation of H2A , H2B and H 4 was also enhanced in the TISP 40 ( / ) testis . ^^^
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA
Interacting proteins: Q16777 and Q16778	Pubmed	SVM Score :0.0
NA